Review



cell lines human hela atcc ccl  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    ATCC cell lines human hela atcc ccl
    Cell Lines Human Hela Atcc Ccl, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 24175 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hela+cells+atcc+ccl+2+human/HeLa/pm42259291-291-140-144
    Average 99 stars, based on 24175 article reviews
    cell lines human hela atcc ccl - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: The mammalian midbody and midbody remnant are assembly sites for RNA and localized translation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Anti-a-tubulin, clone DM1A, Alexa Fluor 555 conjugate (mouse monoclonal) EMD Millipore Cat#05-829X-555 Anti-a-tubulin, clone DM1A, Alexa Fluor 647 conjugate (mouse monoclonal) EMD Millipore Cat#05-829-AF647 Alexa Fluor 488-conjugated AffiniPure Goat Anti-Rabbit IgG (H+L) Jackson ImmunoResearch Cat#111-545-003 Alexa Fluor 568 Dnk Anti-Mouse IgG Abcam Cat#ab175472 Alexa Fluor 594-conjugated AffiniPure Sheep Anti-Mouse IgG (H+L) Jackson ImmunoResearch Cat#515-585-003 Alexa Fluor 647-conjugated AffiniPure Goat Anti-Rabbit IgG (H+L) Jackson ImmunoResearch Cat#111-605-003 Goat anti-Mouse IgG (H+L) CrossAdsorbed Secondary Antibody, Alexa Fluor 568 Thermo Fisher Cat#A11004 Chemicals, peptides, and recombinant proteins Nocodazole (25ng/ml or 50ng/ml for HeLa; 100ng/ml for CHO) Sigma Cat#M1404 Puromycin dihydrochloride (final concentration 91mM) Sigma Cat#P8833 Thymidine (final concentration 2mM) Sigma Cat#T1895 1,6-Hexanediol, 99% (final concentration 7.5%; Dissolved by media) Sigma Cat#240117 Cycloheximide (final concentration 335mM) Sigma Cat#C1988 L-Homopropargylglycine hydrochloride (400mM; Water soluble; Extra amount HPG required for Click-iT HPG Alexa Fluor 488 Protein Synthesis Assay Kit) Sigma Cat#900893 Anisomycin (final concentration 9.4mM) Sigma Cat#A9789 Fluoro-Gel Mounting Medium with TES Buffer Electron Microscopy Sciences Cat#17985-30 BP Fluor 555 Azide BroadPharm Cat#BP-25564 AF568 tyramide reagent Thermo Scientific Cat#B40956 AF488 tyramide reagent AAT Bioquest Cat#11070 Phalloidin CruzFluor 555 Santa Cruz Cat#sc-363794 Critical commercial assays Life Technologies click It Plus Opp Af488 Kit 50 (OPP; 20mM; similar amount of puromycin 91mM) Thermo Scientific Cat#C10456 Click-iT HPG Alexa Fluor 488 Protein Synthesis Assay Kit Invitrogen [HPG (400mM) eight times higher concentration than manufaturer’s recommendation] Thermo Scientific Cat#C10428 RPMI, no methionine (for HPG reaction) Thermo Scientific Cat#A1451701 RNAScopeMultiplex Fluorescent Detection Reagent Kit V2 Advanced Cell Diagnostics Cat#323100 PolyA Advanced Cell Diagnostics Cat#318631 dapB Advanced Cell Diagnostics Cat#310043 Cricetulus griseus JUN (targeting 120-1471 of XM_007643818.1) Advanced Cell Diagnostics Cat#563621 Cricetulus griseus KLF4 (targeting 447- 1862 of XM_003511916.2) Advanced Cell Diagnostics Cat#563611 Cricetulus griseus KIF23 (targeting 834- 1819 of NM_001243981.1) Advanced Cell Diagnostics Cat#558051 (Continued on next page) ll OPEN ACCESS Article e2 Developmental Cell 58, 1917–1932.e1–e6, October 9, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Cricetulus griseus ZFP36 (targeting 671- 1622 of XM_007644391.1) Advanced Cell Diagnostics Cat#563631 Hs-Kif23 Advanced Cell Diagnostics Cat#1159491-C1 Hs-KLF4 Advanced Cell Diagnostics Cat#457461 Hs-JUN Advanced Cell Diagnostics Cat#470541 Hs-ANXA11 Advanced Cell Diagnostics Cat#1159481-C1 Hs-EPEMP1 Advanced Cell Diagnostics Cat#493721 Hs-CNCL5 Advanced Cell Diagnostics Cat#433161 Cg-PPIB Advanced Cell Diagnostics Cat#450461 Lipofectamine RNAiMAX Transfection Reagent [(1:35.66) dilution 6ml/OptiMEM 200ml] Thermo Scientific Cat#13-778-075 Opti-MEM media (for siRNAs transfection) Thermo Scientific Cat#31985062 Experimental models: Cell lines Hamster: CHO-K1 cells ATCC CCL-61 Human: HeLa cells ATCC CCL-2 Human: HeLa Kyoto cells Capalbo et al.27 University of Cambridge, UK Human: MKLP1-GFP expressing HeLa Kyoto cells Douglas et al.48 University of Warwick, UK Human: hTERT RPE-1 cells ATCC CRL-4000 Mouse: AtT-20/D16v-F2 cells ATCC CRL-1795 Mouse: Primary hippocampal mouse neural stem cells (NSPC cells) Moore et al.94 University of Wisconsin-Madison Oligonucleotides control A siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-37007 ARC siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-29721 MKLP1 siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-35936 IST1 siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-93481 TIS11B siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-76672 Annexin XI siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-29694 Stau1 siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-76586 ATXN2L siRNA (374nM; dilution 10mMstock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-93060 Software and algorithms ImageJ/FiJI N/A https://fiji.sc ll OPEN ACCESSArticle ..

    Article Title: Shank3 oligomerization governs material properties of the postsynaptic density condensate and synaptic plasticity.
    Article Snippet: Article Shank3 oligomerization governs material properties of the postsynaptic density condensate and synaptic plasticity

    Expressing:

    Article Title: The mammalian midbody and midbody remnant are assembly sites for RNA and localized translation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Anti-a-tubulin, clone DM1A, Alexa Fluor 555 conjugate (mouse monoclonal) EMD Millipore Cat#05-829X-555 Anti-a-tubulin, clone DM1A, Alexa Fluor 647 conjugate (mouse monoclonal) EMD Millipore Cat#05-829-AF647 Alexa Fluor 488-conjugated AffiniPure Goat Anti-Rabbit IgG (H+L) Jackson ImmunoResearch Cat#111-545-003 Alexa Fluor 568 Dnk Anti-Mouse IgG Abcam Cat#ab175472 Alexa Fluor 594-conjugated AffiniPure Sheep Anti-Mouse IgG (H+L) Jackson ImmunoResearch Cat#515-585-003 Alexa Fluor 647-conjugated AffiniPure Goat Anti-Rabbit IgG (H+L) Jackson ImmunoResearch Cat#111-605-003 Goat anti-Mouse IgG (H+L) CrossAdsorbed Secondary Antibody, Alexa Fluor 568 Thermo Fisher Cat#A11004 Chemicals, peptides, and recombinant proteins Nocodazole (25ng/ml or 50ng/ml for HeLa; 100ng/ml for CHO) Sigma Cat#M1404 Puromycin dihydrochloride (final concentration 91mM) Sigma Cat#P8833 Thymidine (final concentration 2mM) Sigma Cat#T1895 1,6-Hexanediol, 99% (final concentration 7.5%; Dissolved by media) Sigma Cat#240117 Cycloheximide (final concentration 335mM) Sigma Cat#C1988 L-Homopropargylglycine hydrochloride (400mM; Water soluble; Extra amount HPG required for Click-iT HPG Alexa Fluor 488 Protein Synthesis Assay Kit) Sigma Cat#900893 Anisomycin (final concentration 9.4mM) Sigma Cat#A9789 Fluoro-Gel Mounting Medium with TES Buffer Electron Microscopy Sciences Cat#17985-30 BP Fluor 555 Azide BroadPharm Cat#BP-25564 AF568 tyramide reagent Thermo Scientific Cat#B40956 AF488 tyramide reagent AAT Bioquest Cat#11070 Phalloidin CruzFluor 555 Santa Cruz Cat#sc-363794 Critical commercial assays Life Technologies click It Plus Opp Af488 Kit 50 (OPP; 20mM; similar amount of puromycin 91mM) Thermo Scientific Cat#C10456 Click-iT HPG Alexa Fluor 488 Protein Synthesis Assay Kit Invitrogen [HPG (400mM) eight times higher concentration than manufaturer’s recommendation] Thermo Scientific Cat#C10428 RPMI, no methionine (for HPG reaction) Thermo Scientific Cat#A1451701 RNAScopeMultiplex Fluorescent Detection Reagent Kit V2 Advanced Cell Diagnostics Cat#323100 PolyA Advanced Cell Diagnostics Cat#318631 dapB Advanced Cell Diagnostics Cat#310043 Cricetulus griseus JUN (targeting 120-1471 of XM_007643818.1) Advanced Cell Diagnostics Cat#563621 Cricetulus griseus KLF4 (targeting 447- 1862 of XM_003511916.2) Advanced Cell Diagnostics Cat#563611 Cricetulus griseus KIF23 (targeting 834- 1819 of NM_001243981.1) Advanced Cell Diagnostics Cat#558051 (Continued on next page) ll OPEN ACCESS Article e2 Developmental Cell 58, 1917–1932.e1–e6, October 9, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Cricetulus griseus ZFP36 (targeting 671- 1622 of XM_007644391.1) Advanced Cell Diagnostics Cat#563631 Hs-Kif23 Advanced Cell Diagnostics Cat#1159491-C1 Hs-KLF4 Advanced Cell Diagnostics Cat#457461 Hs-JUN Advanced Cell Diagnostics Cat#470541 Hs-ANXA11 Advanced Cell Diagnostics Cat#1159481-C1 Hs-EPEMP1 Advanced Cell Diagnostics Cat#493721 Hs-CNCL5 Advanced Cell Diagnostics Cat#433161 Cg-PPIB Advanced Cell Diagnostics Cat#450461 Lipofectamine RNAiMAX Transfection Reagent [(1:35.66) dilution 6ml/OptiMEM 200ml] Thermo Scientific Cat#13-778-075 Opti-MEM media (for siRNAs transfection) Thermo Scientific Cat#31985062 Experimental models: Cell lines Hamster: CHO-K1 cells ATCC CCL-61 Human: HeLa cells ATCC CCL-2 Human: HeLa Kyoto cells Capalbo et al.27 University of Cambridge, UK Human: MKLP1-GFP expressing HeLa Kyoto cells Douglas et al.48 University of Warwick, UK Human: hTERT RPE-1 cells ATCC CRL-4000 Mouse: AtT-20/D16v-F2 cells ATCC CRL-1795 Mouse: Primary hippocampal mouse neural stem cells (NSPC cells) Moore et al.94 University of Wisconsin-Madison Oligonucleotides control A siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-37007 ARC siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-29721 MKLP1 siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-35936 IST1 siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-93481 TIS11B siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-76672 Annexin XI siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-29694 Stau1 siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-76586 ATXN2L siRNA (374nM; dilution 10mMstock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-93060 Software and algorithms ImageJ/FiJI N/A https://fiji.sc ll OPEN ACCESSArticle ..

    Control:

    Article Title: The mammalian midbody and midbody remnant are assembly sites for RNA and localized translation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Anti-a-tubulin, clone DM1A, Alexa Fluor 555 conjugate (mouse monoclonal) EMD Millipore Cat#05-829X-555 Anti-a-tubulin, clone DM1A, Alexa Fluor 647 conjugate (mouse monoclonal) EMD Millipore Cat#05-829-AF647 Alexa Fluor 488-conjugated AffiniPure Goat Anti-Rabbit IgG (H+L) Jackson ImmunoResearch Cat#111-545-003 Alexa Fluor 568 Dnk Anti-Mouse IgG Abcam Cat#ab175472 Alexa Fluor 594-conjugated AffiniPure Sheep Anti-Mouse IgG (H+L) Jackson ImmunoResearch Cat#515-585-003 Alexa Fluor 647-conjugated AffiniPure Goat Anti-Rabbit IgG (H+L) Jackson ImmunoResearch Cat#111-605-003 Goat anti-Mouse IgG (H+L) CrossAdsorbed Secondary Antibody, Alexa Fluor 568 Thermo Fisher Cat#A11004 Chemicals, peptides, and recombinant proteins Nocodazole (25ng/ml or 50ng/ml for HeLa; 100ng/ml for CHO) Sigma Cat#M1404 Puromycin dihydrochloride (final concentration 91mM) Sigma Cat#P8833 Thymidine (final concentration 2mM) Sigma Cat#T1895 1,6-Hexanediol, 99% (final concentration 7.5%; Dissolved by media) Sigma Cat#240117 Cycloheximide (final concentration 335mM) Sigma Cat#C1988 L-Homopropargylglycine hydrochloride (400mM; Water soluble; Extra amount HPG required for Click-iT HPG Alexa Fluor 488 Protein Synthesis Assay Kit) Sigma Cat#900893 Anisomycin (final concentration 9.4mM) Sigma Cat#A9789 Fluoro-Gel Mounting Medium with TES Buffer Electron Microscopy Sciences Cat#17985-30 BP Fluor 555 Azide BroadPharm Cat#BP-25564 AF568 tyramide reagent Thermo Scientific Cat#B40956 AF488 tyramide reagent AAT Bioquest Cat#11070 Phalloidin CruzFluor 555 Santa Cruz Cat#sc-363794 Critical commercial assays Life Technologies click It Plus Opp Af488 Kit 50 (OPP; 20mM; similar amount of puromycin 91mM) Thermo Scientific Cat#C10456 Click-iT HPG Alexa Fluor 488 Protein Synthesis Assay Kit Invitrogen [HPG (400mM) eight times higher concentration than manufaturer’s recommendation] Thermo Scientific Cat#C10428 RPMI, no methionine (for HPG reaction) Thermo Scientific Cat#A1451701 RNAScopeMultiplex Fluorescent Detection Reagent Kit V2 Advanced Cell Diagnostics Cat#323100 PolyA Advanced Cell Diagnostics Cat#318631 dapB Advanced Cell Diagnostics Cat#310043 Cricetulus griseus JUN (targeting 120-1471 of XM_007643818.1) Advanced Cell Diagnostics Cat#563621 Cricetulus griseus KLF4 (targeting 447- 1862 of XM_003511916.2) Advanced Cell Diagnostics Cat#563611 Cricetulus griseus KIF23 (targeting 834- 1819 of NM_001243981.1) Advanced Cell Diagnostics Cat#558051 (Continued on next page) ll OPEN ACCESS Article e2 Developmental Cell 58, 1917–1932.e1–e6, October 9, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Cricetulus griseus ZFP36 (targeting 671- 1622 of XM_007644391.1) Advanced Cell Diagnostics Cat#563631 Hs-Kif23 Advanced Cell Diagnostics Cat#1159491-C1 Hs-KLF4 Advanced Cell Diagnostics Cat#457461 Hs-JUN Advanced Cell Diagnostics Cat#470541 Hs-ANXA11 Advanced Cell Diagnostics Cat#1159481-C1 Hs-EPEMP1 Advanced Cell Diagnostics Cat#493721 Hs-CNCL5 Advanced Cell Diagnostics Cat#433161 Cg-PPIB Advanced Cell Diagnostics Cat#450461 Lipofectamine RNAiMAX Transfection Reagent [(1:35.66) dilution 6ml/OptiMEM 200ml] Thermo Scientific Cat#13-778-075 Opti-MEM media (for siRNAs transfection) Thermo Scientific Cat#31985062 Experimental models: Cell lines Hamster: CHO-K1 cells ATCC CCL-61 Human: HeLa cells ATCC CCL-2 Human: HeLa Kyoto cells Capalbo et al.27 University of Cambridge, UK Human: MKLP1-GFP expressing HeLa Kyoto cells Douglas et al.48 University of Warwick, UK Human: hTERT RPE-1 cells ATCC CRL-4000 Mouse: AtT-20/D16v-F2 cells ATCC CRL-1795 Mouse: Primary hippocampal mouse neural stem cells (NSPC cells) Moore et al.94 University of Wisconsin-Madison Oligonucleotides control A siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-37007 ARC siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-29721 MKLP1 siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-35936 IST1 siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-93481 TIS11B siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-76672 Annexin XI siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-29694 Stau1 siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-76586 ATXN2L siRNA (374nM; dilution 10mMstock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-93060 Software and algorithms ImageJ/FiJI N/A https://fiji.sc ll OPEN ACCESSArticle ..

    Software:

    Article Title: The mammalian midbody and midbody remnant are assembly sites for RNA and localized translation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Anti-a-tubulin, clone DM1A, Alexa Fluor 555 conjugate (mouse monoclonal) EMD Millipore Cat#05-829X-555 Anti-a-tubulin, clone DM1A, Alexa Fluor 647 conjugate (mouse monoclonal) EMD Millipore Cat#05-829-AF647 Alexa Fluor 488-conjugated AffiniPure Goat Anti-Rabbit IgG (H+L) Jackson ImmunoResearch Cat#111-545-003 Alexa Fluor 568 Dnk Anti-Mouse IgG Abcam Cat#ab175472 Alexa Fluor 594-conjugated AffiniPure Sheep Anti-Mouse IgG (H+L) Jackson ImmunoResearch Cat#515-585-003 Alexa Fluor 647-conjugated AffiniPure Goat Anti-Rabbit IgG (H+L) Jackson ImmunoResearch Cat#111-605-003 Goat anti-Mouse IgG (H+L) CrossAdsorbed Secondary Antibody, Alexa Fluor 568 Thermo Fisher Cat#A11004 Chemicals, peptides, and recombinant proteins Nocodazole (25ng/ml or 50ng/ml for HeLa; 100ng/ml for CHO) Sigma Cat#M1404 Puromycin dihydrochloride (final concentration 91mM) Sigma Cat#P8833 Thymidine (final concentration 2mM) Sigma Cat#T1895 1,6-Hexanediol, 99% (final concentration 7.5%; Dissolved by media) Sigma Cat#240117 Cycloheximide (final concentration 335mM) Sigma Cat#C1988 L-Homopropargylglycine hydrochloride (400mM; Water soluble; Extra amount HPG required for Click-iT HPG Alexa Fluor 488 Protein Synthesis Assay Kit) Sigma Cat#900893 Anisomycin (final concentration 9.4mM) Sigma Cat#A9789 Fluoro-Gel Mounting Medium with TES Buffer Electron Microscopy Sciences Cat#17985-30 BP Fluor 555 Azide BroadPharm Cat#BP-25564 AF568 tyramide reagent Thermo Scientific Cat#B40956 AF488 tyramide reagent AAT Bioquest Cat#11070 Phalloidin CruzFluor 555 Santa Cruz Cat#sc-363794 Critical commercial assays Life Technologies click It Plus Opp Af488 Kit 50 (OPP; 20mM; similar amount of puromycin 91mM) Thermo Scientific Cat#C10456 Click-iT HPG Alexa Fluor 488 Protein Synthesis Assay Kit Invitrogen [HPG (400mM) eight times higher concentration than manufaturer’s recommendation] Thermo Scientific Cat#C10428 RPMI, no methionine (for HPG reaction) Thermo Scientific Cat#A1451701 RNAScopeMultiplex Fluorescent Detection Reagent Kit V2 Advanced Cell Diagnostics Cat#323100 PolyA Advanced Cell Diagnostics Cat#318631 dapB Advanced Cell Diagnostics Cat#310043 Cricetulus griseus JUN (targeting 120-1471 of XM_007643818.1) Advanced Cell Diagnostics Cat#563621 Cricetulus griseus KLF4 (targeting 447- 1862 of XM_003511916.2) Advanced Cell Diagnostics Cat#563611 Cricetulus griseus KIF23 (targeting 834- 1819 of NM_001243981.1) Advanced Cell Diagnostics Cat#558051 (Continued on next page) ll OPEN ACCESS Article e2 Developmental Cell 58, 1917–1932.e1–e6, October 9, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Cricetulus griseus ZFP36 (targeting 671- 1622 of XM_007644391.1) Advanced Cell Diagnostics Cat#563631 Hs-Kif23 Advanced Cell Diagnostics Cat#1159491-C1 Hs-KLF4 Advanced Cell Diagnostics Cat#457461 Hs-JUN Advanced Cell Diagnostics Cat#470541 Hs-ANXA11 Advanced Cell Diagnostics Cat#1159481-C1 Hs-EPEMP1 Advanced Cell Diagnostics Cat#493721 Hs-CNCL5 Advanced Cell Diagnostics Cat#433161 Cg-PPIB Advanced Cell Diagnostics Cat#450461 Lipofectamine RNAiMAX Transfection Reagent [(1:35.66) dilution 6ml/OptiMEM 200ml] Thermo Scientific Cat#13-778-075 Opti-MEM media (for siRNAs transfection) Thermo Scientific Cat#31985062 Experimental models: Cell lines Hamster: CHO-K1 cells ATCC CCL-61 Human: HeLa cells ATCC CCL-2 Human: HeLa Kyoto cells Capalbo et al.27 University of Cambridge, UK Human: MKLP1-GFP expressing HeLa Kyoto cells Douglas et al.48 University of Warwick, UK Human: hTERT RPE-1 cells ATCC CRL-4000 Mouse: AtT-20/D16v-F2 cells ATCC CRL-1795 Mouse: Primary hippocampal mouse neural stem cells (NSPC cells) Moore et al.94 University of Wisconsin-Madison Oligonucleotides control A siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-37007 ARC siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-29721 MKLP1 siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-35936 IST1 siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-93481 TIS11B siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-76672 Annexin XI siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-29694 Stau1 siRNA (374nM; dilution 10mM stock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-76586 ATXN2L siRNA (374nM; dilution 10mMstock 8ul/Opti-MEM 200ml) Santa Cruz Cat#sc-93060 Software and algorithms ImageJ/FiJI N/A https://fiji.sc ll OPEN ACCESSArticle ..

    Article Title: A reversible metabolic stress-sensitive regulation of CRMP2A orchestrates EMT/stemness and increases metastatic potential in cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: HeLa cells ATCC CCL-2 Human: HFF-1 cells ATCC SCRC-1041 Human: HEK-293 cells ATCC CRL-1573.3 Human: HGPS Fibroblasts from Skin, Arm (Passage 8) NIA Aging Cell Culture Repository AG03513 Human: Hs578 T cells ATCC HTB-126 Human: MCF-7 cells ATCC HTB-22 Human: MDA-MB-231 cells ATCC HTB-26 Human: Renal Proximal Tubular Epithelial Cells ScienCell Research Laboratories 4100 Human: Small Airway Epithelial Cells ScienCell Research Laboratories 3230 Human: SW480 cells ATCC CCL-228 Human: SW620 cells ATCC CCL-227 Human: U2-OS cells ATCC HTB-96 Mouse: 4T1 cells Barbara Ann Karmanos Cancer Institute N/A Mouse: 67NR cells Barbara Ann Karmanos Cancer Institute N/A Mouse: Mouse Embryonic Fibroblasts ATCC SCRC-1008 Experimental models: Organisms/strains Mouse: Crl:NU-Foxn1nu Charles River Canada 088 (Homozygous) Oligonucleotides c-Myc siRNA (Exon 1-targeting) 1.1 (ID: ABRSAC8) Ambion Cat# (custom) c-Myc siRNA (Exon 1-targeting) 1.2 (ID: ABVI4VW) Ambion Cat# (custom) c-Myc siRNA (Exon 2-targeting) (ID: VHS407089) Ambion Cat# 1299001 c-Myc siRNA (Exon 3-targeting) 3.1 (ID: s9130) Ambion Cat# 4392420 c-Myc siRNA (Exon 3-targeting) 3.2 (ID: s9131) Ambion Cat# 4392420 CRMP2A siRNA (ID: CD.Ri.63593.13.14) iDT Cat# (custom) HIF-1a siRNA (ID: 42840) Ambion Cat# AM51331 SIRT3 siRNA (ID: s23768) Ambion Cat# 4392420 TFAM siRNA (ID: s14000) Ambion Cat# 4427037 For primers used in ChIP, see Table S1 This paper N/A Software and algorithms GeneAnalytics LifeMap Sciences https://geneanalytics.genecards.org GraphPad Prism (v8.0) GraphPad Software https://www.graphpad.com Image J (v1.53 h) NIH https://imagej.nih.gov ..

    Article Title: Mitochondrial protein import stress regulates the LC3 lipidation step of mitophagy through NLRX1 and RRBP1.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies NLRX1 mouse monoclonal Thermo Fisher Scientific MA5-27207 NLRX1 EMD Millipore 06-1342 NLRX1 Proteintech 17215-1-AP RRBP1 Thermo Fisher Scientific PA5-21392 RRBP1 Bethyl Laboratories A303-997A RRBP1 Thermo Fisher Scientific MA5-18289 Tubulin Millipore Sigma T9026 VDAC1 abcam ab14734 COX4 Abcam ab33985 LC3B Cell Signaling 3868S LC3A/B Cell Signaling 4108S Calreticulin Encor biotechnology MCA-6C6 FLAG Millipore Sigma F1804 cleaved PARP1 Cell Signaling 5625S PINK1 Novus BC100-494 SDHB Abcam ab14714 SYNJ2BP Invitrogen PA5-51471 Kinectin H-190 Santa Cruz sc-33562 Sec61b Millipore Sigma 07-205 Calnexin BD transduction laboratories, 610523 RPL26 Invitrogen PA5-17093 SFPQ Abcam ab11825 PET117 Thermo Fisher Scientific PA5-61574 COX2 Abcam ab110258 TOM20 Cell Signaling 42406 TIM23 Proteintech 11123-1-AP LAMP-1 Cell Signaling 9091S LAMP-2 Thermo Fisher Scientific MA1-205 HRP rabbit Jackson Immuno Research Laboratories 111-035-003 HRP mouse Jackson Immuno Research Laboratories 115-035-003 Alexa fluor 488 rabbit Life Technologies A11034 Cy3-conjugated goat anti-mouse Jackson Immuno Research Laboratories 115-165-003 Hoechst Millipore Sigma B2261 Chemicals, peptides, and recombinant proteins Protease Inhibitor Cocktail Millipore Sigma P8340 FuGENE HD Transfection Reagent Promega E2311 Lipofectamine RNAiMAX Transfection Reagent Thermo Fisher Scientific 13778075 CCCP Millipore Sigma C2759 Glucose Millipore Sigma G7021 A23187 Millipore Sigma C7522 Cycloheximide Millipore Sigma C7698 Puromycin Millipore Sigma P8833 MitoBloCK-6 Millipore Sigma 5.05759.0001 (Continued on next page) e1 Molecular Cell 82, 2815–2831.e1–e5, August 4, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligomycin A Millipore Sigma 75351 Antimycin A Millipore Sigma A8674 Torin 1 Millipore Sigma 475991 Critical commercial assays Endoplasmic Reticulum isolation kit Millipore Sigma ER0100 CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Deposited Data Proteomic data – ProteomeXchange (jPOST) This paper ProteomeXchange: PXD034231; jPOST: JPST001604 Experimental models: Cell lines Human: HEK293T cells ATCC CRL-3216 Human: HeLa cells ATCC CCL-2 Human: HCT116 cells ATCC CCL-247 Mouse: MEF cells Soares et al. 2013 N/A Experimental models: Organisms/strains Mouse: C57Bl/6 Soares et al. 2013 N/A Oligonucleotides shRNA against RRBP1: CCGGCCTAATGGGAAGA TACCTGATCTCGAGATCAGGTATCTTCCCATTAG GTTTTTG Millipore Sigma TRCN0000117407 shRNA against NLRX1: GAGGAGGACTACTACAACGAT Abdul-Sater et al., 2010 N/A shRNA against PINK1: CGGCTGGAGGAGTATCTGATA Millipore Sigma TRCN0000007101 shRNA scramble sequence: GTGCAGGAGTAGGGCATTTAA Abdul-Sater et al., 2010 N/A siRNA against TOM20 Thermo Fisher Scientific 4392420-s18950 siRNA against TIM23 Thermo Fisher Scientific 4390824-s223113 NLRX1 genotyping FW primer: GGC CCT CTT TTA GCT GTT TCA Soares et al., 2013 N/A NLRX1 genotyping RV primer: CGA TCC CAT TCC CCA TTA TT Soares et al., 2013 N/A Software and algorithms GraphPad Prism 8 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Scaffold 5 Proteome Software https://www.proteomesoftware.com/ products/scaffold-5 ..

    Article Title: Bimodal endocytic probe for three-dimensional correlative light and electron microscopy
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-LAMP1 BD Pharmigen Cat# 555798, RRID:AB_396132 Rabbit anti-EEA1 Cell Signaling technology Cat# 3288, RRID:AB_2096811 Mouse anti-CD63 Developmental Studies Hybridoma Bank Cat# h5c6, RRID:AB_528158 Rabbit anti-Mouse ZYMED Cat# 61-6800, RRID:AB_88323 Donkey anti-Mouse Alexa-488 Life Technologies Cat# A-21202, RRID:AB_141607 Goat anti-Mouse Alexa-647 Life Technologies Cat# A-21235, RRID:AB_2535804 Donkey anti-Rabbit Alexa-647 Life Technologies Cat# A-31573, RRID:AB_2536183 Donkey anti-Rabbit Alexa-568 Life Technologies Cat# A10042, RRID:AB_2534017 Donkey anti-Rabbit Alexa-488 Life Technologies Cat# A-21206, RRID:AB_2535792 Protein A – Au conjugate (10 nm) Cell Microscopy Core, UMC Utrecht https://cellbiology-utrecht.nl/products.html Chemicals, peptides, and recombinant proteins fBSA-Au5 Cell Microscopy Core, UMC Utrecht https://cellbiology-utrecht.nl/products.html fBSA-Au10 Cell Microscopy Core, UMC Utrecht https://cellbiology-utrecht.nl/products.html Chloroauric acid trihydrate Merck 1.01582 Tannic Acid Mallinckrodt Pharmaceuticals 1764 Bovine Serum Albumin Sigma-Aldrich A9647 BSA Alexa FluorTM 555 conjugate Invitrogen, ThermoFisher A34786 Protein-A GE Healthcare 17-0872-50 Methylcellulose Sigma-Aldrich M-6385 Paraformaldehyde Sigma-Aldrich 441244 Glutaraldehyde Polysciences 1201 Osmium Tetroxide Electron Microscopy Sciences 19132 Uranylacetate SPI-Chem 02624-AB Embed 812 Electron Microscopy Sciences 14900 Lowicryl HM20 Polysciences 23994 Deposited data Raw and analyzed data This paper N/A Experimental models: Cell lines Human: HeLa cells ATCC CCL-2 Human: U2OS cells ATCC HTB-96 Mouse: Dorsal root ganglion (DRG) neurons Foster et al., 2022 N/A Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Icy De Chaumont et al., 2012 https://icy.bioimageanalysis.org/ ec-CLEM Paul-Gilloteaux et al., 2017 https://icy.bioimageanalysis.org/plugin/ec-clem/ PSA particle size analyzer for ImageJ Ralph Sperling, Institut Català de Nanotecnologia https://github.com/psa-rs/psa-macro ComDet Eugene Katrukha, Utrecht University https://imagej.net/plugins/spots- colocalization-comdet IMOD Mastronarde and Held, 2017 https://bio3d.colorado.edu/imod/ serialEM Mastronarde, 2018 https://bio3d.colorado.edu/SerialEM/index.html Other Electron Microscopy Grids This paper https://cellbiology-utrecht.nl/products.html e1 Cell Reports Methods 2, 100220, May 23, 2022 Article ll OPEN ACCESS ..

    Article Title: Systematic profiling of cytosolic membraneless organelles reveals enrichment of oncogenic mRNA upon oxidative stress.
    Article Snippet: pLX304-Flag-APEX-NES was a gift from Alice Ting (Addgene plasmid #92158; https://www.addgene.org/92158/; RRID: Addgene_92158).82 For DDX6-APEX2 fusion, the backbone of the APEX2-FLAG expression vector was amplified and inserted into a .. REAGENT or RESOURCE SOURCE IDENTIFIER Live Imaging Videos FigShare – This paper https://doi.org/10.6084/m9.figshare.27948777 Western Blot Images FigShare – This paper https://doi.org/10.6084/m9.figshare.27948777 Experimental models: Cell lines Human: HeLa cells ATCC CCL-2 Human: HEK293T cells ATCC CRL-3216 Human: HeLa APEX-FLAG cells This paper N/A Human: HeLa APEX-DDX6 cells This paper N/A Human: HeLa APEX-G3BP cells This paper N/A Human: HeLa G3BP-GFP DDX6-RFP cells This paper N/A Recombinant DNA pLX304-Flag-APEX-NES Alice Ting Addgene plasmid #92158; RRID: Addgene_92158 Phage UbiC tagRFP-DDX6 Jeffrey Chao Addgene plasmid #119947; RRID: Addgene_119947 Phage UbiC G3BP1-GFP-GFP Jeffrey Chao Addgene plasmid #119950; RRID: Addgene_119950 pCAG-HIVgp plasmid Miyoshi et al.67 #RDB04394 pCMV-VSV-G-RSV-Rev plasmid Miyoshi et al.67 #RDB04393 Custom Plasmids – see Table 1 This Paper N/A Software and algorithms FastQC v0.11.9 Andrews68 https://github.com/s-andrews/FastQC Trimmomatic v0.39 Bolger et al.69 https://github.com/usadellab/Trimmomatic Whippet Sterne-Weiler et al.70 https://github.com/timbitz/Whippet.jl DESeq2 v1.36.0 Love et al.71 http://www.bioconductor.org/packages/ release/bioc/html/DESeq2.html gProfiler v4.4.4 Raudvere et al.72 https://biit.cs.ut.ee/gprofiler/gost REVIGO Supek et al.73 http://revigo.irb.hr/ GGplot2 Villanueva et al.74 https://ggplot2.tidyverse.org pheatmap Kolde75 https://github.com/raivokolde/pheatmap IUPred2A Erdos et al.76 https://iupred2a.elte.hu/ Bedtools Quinlan et al.77 https://bedtools.readthedocs.io/en/latest/ statsmodels.stats.multitest Seabold et al.78 https://www.statsmodels.org/dev/generated/ statsmodels.stats.multitest.multipletests.html FiJi v1.53 Schindelin et al.79 https://imagej.net/software/fiji/ CellProfiler v4.2.4 Stirling et al.32 https://github.com/CellProfiler/CellProfiler Ilastik v1.3.3 Berg et al.33 https://www.ilastik.org/download cytominer v0.2.2 Singh et al.80 https://github.com/cytomining/cytominer Morpheus Broad Institute https://software.broadinstitute.org/morpheus JACoP plugin Bolte et al.81 https://imagej.net/plugins/jacop FlowJo BD Life Sciences https://www.flowjo.com Cell Reports 45, 117203, April 28, 2026 17 pcDNA3.1 vector in combination with the DDX6 ORF from phage UbiC tagRFP-DDX6 using the HiFi NEBuilder cloning kit (NEBiolabs) and partially overlapping primers (Table 1). ..

    Cell Culture:

    Article Title: A reversible metabolic stress-sensitive regulation of CRMP2A orchestrates EMT/stemness and increases metastatic potential in cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: HeLa cells ATCC CCL-2 Human: HFF-1 cells ATCC SCRC-1041 Human: HEK-293 cells ATCC CRL-1573.3 Human: HGPS Fibroblasts from Skin, Arm (Passage 8) NIA Aging Cell Culture Repository AG03513 Human: Hs578 T cells ATCC HTB-126 Human: MCF-7 cells ATCC HTB-22 Human: MDA-MB-231 cells ATCC HTB-26 Human: Renal Proximal Tubular Epithelial Cells ScienCell Research Laboratories 4100 Human: Small Airway Epithelial Cells ScienCell Research Laboratories 3230 Human: SW480 cells ATCC CCL-228 Human: SW620 cells ATCC CCL-227 Human: U2-OS cells ATCC HTB-96 Mouse: 4T1 cells Barbara Ann Karmanos Cancer Institute N/A Mouse: 67NR cells Barbara Ann Karmanos Cancer Institute N/A Mouse: Mouse Embryonic Fibroblasts ATCC SCRC-1008 Experimental models: Organisms/strains Mouse: Crl:NU-Foxn1nu Charles River Canada 088 (Homozygous) Oligonucleotides c-Myc siRNA (Exon 1-targeting) 1.1 (ID: ABRSAC8) Ambion Cat# (custom) c-Myc siRNA (Exon 1-targeting) 1.2 (ID: ABVI4VW) Ambion Cat# (custom) c-Myc siRNA (Exon 2-targeting) (ID: VHS407089) Ambion Cat# 1299001 c-Myc siRNA (Exon 3-targeting) 3.1 (ID: s9130) Ambion Cat# 4392420 c-Myc siRNA (Exon 3-targeting) 3.2 (ID: s9131) Ambion Cat# 4392420 CRMP2A siRNA (ID: CD.Ri.63593.13.14) iDT Cat# (custom) HIF-1a siRNA (ID: 42840) Ambion Cat# AM51331 SIRT3 siRNA (ID: s23768) Ambion Cat# 4392420 TFAM siRNA (ID: s14000) Ambion Cat# 4427037 For primers used in ChIP, see Table S1 This paper N/A Software and algorithms GeneAnalytics LifeMap Sciences https://geneanalytics.genecards.org GraphPad Prism (v8.0) GraphPad Software https://www.graphpad.com Image J (v1.53 h) NIH https://imagej.nih.gov ..

    Multiple Displacement Amplification:

    Article Title: A reversible metabolic stress-sensitive regulation of CRMP2A orchestrates EMT/stemness and increases metastatic potential in cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: HeLa cells ATCC CCL-2 Human: HFF-1 cells ATCC SCRC-1041 Human: HEK-293 cells ATCC CRL-1573.3 Human: HGPS Fibroblasts from Skin, Arm (Passage 8) NIA Aging Cell Culture Repository AG03513 Human: Hs578 T cells ATCC HTB-126 Human: MCF-7 cells ATCC HTB-22 Human: MDA-MB-231 cells ATCC HTB-26 Human: Renal Proximal Tubular Epithelial Cells ScienCell Research Laboratories 4100 Human: Small Airway Epithelial Cells ScienCell Research Laboratories 3230 Human: SW480 cells ATCC CCL-228 Human: SW620 cells ATCC CCL-227 Human: U2-OS cells ATCC HTB-96 Mouse: 4T1 cells Barbara Ann Karmanos Cancer Institute N/A Mouse: 67NR cells Barbara Ann Karmanos Cancer Institute N/A Mouse: Mouse Embryonic Fibroblasts ATCC SCRC-1008 Experimental models: Organisms/strains Mouse: Crl:NU-Foxn1nu Charles River Canada 088 (Homozygous) Oligonucleotides c-Myc siRNA (Exon 1-targeting) 1.1 (ID: ABRSAC8) Ambion Cat# (custom) c-Myc siRNA (Exon 1-targeting) 1.2 (ID: ABVI4VW) Ambion Cat# (custom) c-Myc siRNA (Exon 2-targeting) (ID: VHS407089) Ambion Cat# 1299001 c-Myc siRNA (Exon 3-targeting) 3.1 (ID: s9130) Ambion Cat# 4392420 c-Myc siRNA (Exon 3-targeting) 3.2 (ID: s9131) Ambion Cat# 4392420 CRMP2A siRNA (ID: CD.Ri.63593.13.14) iDT Cat# (custom) HIF-1a siRNA (ID: 42840) Ambion Cat# AM51331 SIRT3 siRNA (ID: s23768) Ambion Cat# 4392420 TFAM siRNA (ID: s14000) Ambion Cat# 4427037 For primers used in ChIP, see Table S1 This paper N/A Software and algorithms GeneAnalytics LifeMap Sciences https://geneanalytics.genecards.org GraphPad Prism (v8.0) GraphPad Software https://www.graphpad.com Image J (v1.53 h) NIH https://imagej.nih.gov ..

    Chromatin Immunoprecipitation:

    Article Title: A reversible metabolic stress-sensitive regulation of CRMP2A orchestrates EMT/stemness and increases metastatic potential in cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: HeLa cells ATCC CCL-2 Human: HFF-1 cells ATCC SCRC-1041 Human: HEK-293 cells ATCC CRL-1573.3 Human: HGPS Fibroblasts from Skin, Arm (Passage 8) NIA Aging Cell Culture Repository AG03513 Human: Hs578 T cells ATCC HTB-126 Human: MCF-7 cells ATCC HTB-22 Human: MDA-MB-231 cells ATCC HTB-26 Human: Renal Proximal Tubular Epithelial Cells ScienCell Research Laboratories 4100 Human: Small Airway Epithelial Cells ScienCell Research Laboratories 3230 Human: SW480 cells ATCC CCL-228 Human: SW620 cells ATCC CCL-227 Human: U2-OS cells ATCC HTB-96 Mouse: 4T1 cells Barbara Ann Karmanos Cancer Institute N/A Mouse: 67NR cells Barbara Ann Karmanos Cancer Institute N/A Mouse: Mouse Embryonic Fibroblasts ATCC SCRC-1008 Experimental models: Organisms/strains Mouse: Crl:NU-Foxn1nu Charles River Canada 088 (Homozygous) Oligonucleotides c-Myc siRNA (Exon 1-targeting) 1.1 (ID: ABRSAC8) Ambion Cat# (custom) c-Myc siRNA (Exon 1-targeting) 1.2 (ID: ABVI4VW) Ambion Cat# (custom) c-Myc siRNA (Exon 2-targeting) (ID: VHS407089) Ambion Cat# 1299001 c-Myc siRNA (Exon 3-targeting) 3.1 (ID: s9130) Ambion Cat# 4392420 c-Myc siRNA (Exon 3-targeting) 3.2 (ID: s9131) Ambion Cat# 4392420 CRMP2A siRNA (ID: CD.Ri.63593.13.14) iDT Cat# (custom) HIF-1a siRNA (ID: 42840) Ambion Cat# AM51331 SIRT3 siRNA (ID: s23768) Ambion Cat# 4392420 TFAM siRNA (ID: s14000) Ambion Cat# 4427037 For primers used in ChIP, see Table S1 This paper N/A Software and algorithms GeneAnalytics LifeMap Sciences https://geneanalytics.genecards.org GraphPad Prism (v8.0) GraphPad Software https://www.graphpad.com Image J (v1.53 h) NIH https://imagej.nih.gov ..

    other:

    Article Title: UMP functions as an endogenous regulator of NR4A1 to control gastric cancer progression.
    Article Snippet: Article UMP functions as an endogenous regulator of NR4A1 to control gastric cancer progression

    Isolation:

    Article Title: Mitochondrial protein import stress regulates the LC3 lipidation step of mitophagy through NLRX1 and RRBP1.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies NLRX1 mouse monoclonal Thermo Fisher Scientific MA5-27207 NLRX1 EMD Millipore 06-1342 NLRX1 Proteintech 17215-1-AP RRBP1 Thermo Fisher Scientific PA5-21392 RRBP1 Bethyl Laboratories A303-997A RRBP1 Thermo Fisher Scientific MA5-18289 Tubulin Millipore Sigma T9026 VDAC1 abcam ab14734 COX4 Abcam ab33985 LC3B Cell Signaling 3868S LC3A/B Cell Signaling 4108S Calreticulin Encor biotechnology MCA-6C6 FLAG Millipore Sigma F1804 cleaved PARP1 Cell Signaling 5625S PINK1 Novus BC100-494 SDHB Abcam ab14714 SYNJ2BP Invitrogen PA5-51471 Kinectin H-190 Santa Cruz sc-33562 Sec61b Millipore Sigma 07-205 Calnexin BD transduction laboratories, 610523 RPL26 Invitrogen PA5-17093 SFPQ Abcam ab11825 PET117 Thermo Fisher Scientific PA5-61574 COX2 Abcam ab110258 TOM20 Cell Signaling 42406 TIM23 Proteintech 11123-1-AP LAMP-1 Cell Signaling 9091S LAMP-2 Thermo Fisher Scientific MA1-205 HRP rabbit Jackson Immuno Research Laboratories 111-035-003 HRP mouse Jackson Immuno Research Laboratories 115-035-003 Alexa fluor 488 rabbit Life Technologies A11034 Cy3-conjugated goat anti-mouse Jackson Immuno Research Laboratories 115-165-003 Hoechst Millipore Sigma B2261 Chemicals, peptides, and recombinant proteins Protease Inhibitor Cocktail Millipore Sigma P8340 FuGENE HD Transfection Reagent Promega E2311 Lipofectamine RNAiMAX Transfection Reagent Thermo Fisher Scientific 13778075 CCCP Millipore Sigma C2759 Glucose Millipore Sigma G7021 A23187 Millipore Sigma C7522 Cycloheximide Millipore Sigma C7698 Puromycin Millipore Sigma P8833 MitoBloCK-6 Millipore Sigma 5.05759.0001 (Continued on next page) e1 Molecular Cell 82, 2815–2831.e1–e5, August 4, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligomycin A Millipore Sigma 75351 Antimycin A Millipore Sigma A8674 Torin 1 Millipore Sigma 475991 Critical commercial assays Endoplasmic Reticulum isolation kit Millipore Sigma ER0100 CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Deposited Data Proteomic data – ProteomeXchange (jPOST) This paper ProteomeXchange: PXD034231; jPOST: JPST001604 Experimental models: Cell lines Human: HEK293T cells ATCC CRL-3216 Human: HeLa cells ATCC CCL-2 Human: HCT116 cells ATCC CCL-247 Mouse: MEF cells Soares et al. 2013 N/A Experimental models: Organisms/strains Mouse: C57Bl/6 Soares et al. 2013 N/A Oligonucleotides shRNA against RRBP1: CCGGCCTAATGGGAAGA TACCTGATCTCGAGATCAGGTATCTTCCCATTAG GTTTTTG Millipore Sigma TRCN0000117407 shRNA against NLRX1: GAGGAGGACTACTACAACGAT Abdul-Sater et al., 2010 N/A shRNA against PINK1: CGGCTGGAGGAGTATCTGATA Millipore Sigma TRCN0000007101 shRNA scramble sequence: GTGCAGGAGTAGGGCATTTAA Abdul-Sater et al., 2010 N/A siRNA against TOM20 Thermo Fisher Scientific 4392420-s18950 siRNA against TIM23 Thermo Fisher Scientific 4390824-s223113 NLRX1 genotyping FW primer: GGC CCT CTT TTA GCT GTT TCA Soares et al., 2013 N/A NLRX1 genotyping RV primer: CGA TCC CAT TCC CCA TTA TT Soares et al., 2013 N/A Software and algorithms GraphPad Prism 8 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Scaffold 5 Proteome Software https://www.proteomesoftware.com/ products/scaffold-5 ..

    Cell Viability Assay:

    Article Title: Mitochondrial protein import stress regulates the LC3 lipidation step of mitophagy through NLRX1 and RRBP1.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies NLRX1 mouse monoclonal Thermo Fisher Scientific MA5-27207 NLRX1 EMD Millipore 06-1342 NLRX1 Proteintech 17215-1-AP RRBP1 Thermo Fisher Scientific PA5-21392 RRBP1 Bethyl Laboratories A303-997A RRBP1 Thermo Fisher Scientific MA5-18289 Tubulin Millipore Sigma T9026 VDAC1 abcam ab14734 COX4 Abcam ab33985 LC3B Cell Signaling 3868S LC3A/B Cell Signaling 4108S Calreticulin Encor biotechnology MCA-6C6 FLAG Millipore Sigma F1804 cleaved PARP1 Cell Signaling 5625S PINK1 Novus BC100-494 SDHB Abcam ab14714 SYNJ2BP Invitrogen PA5-51471 Kinectin H-190 Santa Cruz sc-33562 Sec61b Millipore Sigma 07-205 Calnexin BD transduction laboratories, 610523 RPL26 Invitrogen PA5-17093 SFPQ Abcam ab11825 PET117 Thermo Fisher Scientific PA5-61574 COX2 Abcam ab110258 TOM20 Cell Signaling 42406 TIM23 Proteintech 11123-1-AP LAMP-1 Cell Signaling 9091S LAMP-2 Thermo Fisher Scientific MA1-205 HRP rabbit Jackson Immuno Research Laboratories 111-035-003 HRP mouse Jackson Immuno Research Laboratories 115-035-003 Alexa fluor 488 rabbit Life Technologies A11034 Cy3-conjugated goat anti-mouse Jackson Immuno Research Laboratories 115-165-003 Hoechst Millipore Sigma B2261 Chemicals, peptides, and recombinant proteins Protease Inhibitor Cocktail Millipore Sigma P8340 FuGENE HD Transfection Reagent Promega E2311 Lipofectamine RNAiMAX Transfection Reagent Thermo Fisher Scientific 13778075 CCCP Millipore Sigma C2759 Glucose Millipore Sigma G7021 A23187 Millipore Sigma C7522 Cycloheximide Millipore Sigma C7698 Puromycin Millipore Sigma P8833 MitoBloCK-6 Millipore Sigma 5.05759.0001 (Continued on next page) e1 Molecular Cell 82, 2815–2831.e1–e5, August 4, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligomycin A Millipore Sigma 75351 Antimycin A Millipore Sigma A8674 Torin 1 Millipore Sigma 475991 Critical commercial assays Endoplasmic Reticulum isolation kit Millipore Sigma ER0100 CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Deposited Data Proteomic data – ProteomeXchange (jPOST) This paper ProteomeXchange: PXD034231; jPOST: JPST001604 Experimental models: Cell lines Human: HEK293T cells ATCC CRL-3216 Human: HeLa cells ATCC CCL-2 Human: HCT116 cells ATCC CCL-247 Mouse: MEF cells Soares et al. 2013 N/A Experimental models: Organisms/strains Mouse: C57Bl/6 Soares et al. 2013 N/A Oligonucleotides shRNA against RRBP1: CCGGCCTAATGGGAAGA TACCTGATCTCGAGATCAGGTATCTTCCCATTAG GTTTTTG Millipore Sigma TRCN0000117407 shRNA against NLRX1: GAGGAGGACTACTACAACGAT Abdul-Sater et al., 2010 N/A shRNA against PINK1: CGGCTGGAGGAGTATCTGATA Millipore Sigma TRCN0000007101 shRNA scramble sequence: GTGCAGGAGTAGGGCATTTAA Abdul-Sater et al., 2010 N/A siRNA against TOM20 Thermo Fisher Scientific 4392420-s18950 siRNA against TIM23 Thermo Fisher Scientific 4390824-s223113 NLRX1 genotyping FW primer: GGC CCT CTT TTA GCT GTT TCA Soares et al., 2013 N/A NLRX1 genotyping RV primer: CGA TCC CAT TCC CCA TTA TT Soares et al., 2013 N/A Software and algorithms GraphPad Prism 8 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Scaffold 5 Proteome Software https://www.proteomesoftware.com/ products/scaffold-5 ..

    shRNA:

    Article Title: Mitochondrial protein import stress regulates the LC3 lipidation step of mitophagy through NLRX1 and RRBP1.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies NLRX1 mouse monoclonal Thermo Fisher Scientific MA5-27207 NLRX1 EMD Millipore 06-1342 NLRX1 Proteintech 17215-1-AP RRBP1 Thermo Fisher Scientific PA5-21392 RRBP1 Bethyl Laboratories A303-997A RRBP1 Thermo Fisher Scientific MA5-18289 Tubulin Millipore Sigma T9026 VDAC1 abcam ab14734 COX4 Abcam ab33985 LC3B Cell Signaling 3868S LC3A/B Cell Signaling 4108S Calreticulin Encor biotechnology MCA-6C6 FLAG Millipore Sigma F1804 cleaved PARP1 Cell Signaling 5625S PINK1 Novus BC100-494 SDHB Abcam ab14714 SYNJ2BP Invitrogen PA5-51471 Kinectin H-190 Santa Cruz sc-33562 Sec61b Millipore Sigma 07-205 Calnexin BD transduction laboratories, 610523 RPL26 Invitrogen PA5-17093 SFPQ Abcam ab11825 PET117 Thermo Fisher Scientific PA5-61574 COX2 Abcam ab110258 TOM20 Cell Signaling 42406 TIM23 Proteintech 11123-1-AP LAMP-1 Cell Signaling 9091S LAMP-2 Thermo Fisher Scientific MA1-205 HRP rabbit Jackson Immuno Research Laboratories 111-035-003 HRP mouse Jackson Immuno Research Laboratories 115-035-003 Alexa fluor 488 rabbit Life Technologies A11034 Cy3-conjugated goat anti-mouse Jackson Immuno Research Laboratories 115-165-003 Hoechst Millipore Sigma B2261 Chemicals, peptides, and recombinant proteins Protease Inhibitor Cocktail Millipore Sigma P8340 FuGENE HD Transfection Reagent Promega E2311 Lipofectamine RNAiMAX Transfection Reagent Thermo Fisher Scientific 13778075 CCCP Millipore Sigma C2759 Glucose Millipore Sigma G7021 A23187 Millipore Sigma C7522 Cycloheximide Millipore Sigma C7698 Puromycin Millipore Sigma P8833 MitoBloCK-6 Millipore Sigma 5.05759.0001 (Continued on next page) e1 Molecular Cell 82, 2815–2831.e1–e5, August 4, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligomycin A Millipore Sigma 75351 Antimycin A Millipore Sigma A8674 Torin 1 Millipore Sigma 475991 Critical commercial assays Endoplasmic Reticulum isolation kit Millipore Sigma ER0100 CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Deposited Data Proteomic data – ProteomeXchange (jPOST) This paper ProteomeXchange: PXD034231; jPOST: JPST001604 Experimental models: Cell lines Human: HEK293T cells ATCC CRL-3216 Human: HeLa cells ATCC CCL-2 Human: HCT116 cells ATCC CCL-247 Mouse: MEF cells Soares et al. 2013 N/A Experimental models: Organisms/strains Mouse: C57Bl/6 Soares et al. 2013 N/A Oligonucleotides shRNA against RRBP1: CCGGCCTAATGGGAAGA TACCTGATCTCGAGATCAGGTATCTTCCCATTAG GTTTTTG Millipore Sigma TRCN0000117407 shRNA against NLRX1: GAGGAGGACTACTACAACGAT Abdul-Sater et al., 2010 N/A shRNA against PINK1: CGGCTGGAGGAGTATCTGATA Millipore Sigma TRCN0000007101 shRNA scramble sequence: GTGCAGGAGTAGGGCATTTAA Abdul-Sater et al., 2010 N/A siRNA against TOM20 Thermo Fisher Scientific 4392420-s18950 siRNA against TIM23 Thermo Fisher Scientific 4390824-s223113 NLRX1 genotyping FW primer: GGC CCT CTT TTA GCT GTT TCA Soares et al., 2013 N/A NLRX1 genotyping RV primer: CGA TCC CAT TCC CCA TTA TT Soares et al., 2013 N/A Software and algorithms GraphPad Prism 8 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Scaffold 5 Proteome Software https://www.proteomesoftware.com/ products/scaffold-5 ..

    Sequencing:

    Article Title: Mitochondrial protein import stress regulates the LC3 lipidation step of mitophagy through NLRX1 and RRBP1.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies NLRX1 mouse monoclonal Thermo Fisher Scientific MA5-27207 NLRX1 EMD Millipore 06-1342 NLRX1 Proteintech 17215-1-AP RRBP1 Thermo Fisher Scientific PA5-21392 RRBP1 Bethyl Laboratories A303-997A RRBP1 Thermo Fisher Scientific MA5-18289 Tubulin Millipore Sigma T9026 VDAC1 abcam ab14734 COX4 Abcam ab33985 LC3B Cell Signaling 3868S LC3A/B Cell Signaling 4108S Calreticulin Encor biotechnology MCA-6C6 FLAG Millipore Sigma F1804 cleaved PARP1 Cell Signaling 5625S PINK1 Novus BC100-494 SDHB Abcam ab14714 SYNJ2BP Invitrogen PA5-51471 Kinectin H-190 Santa Cruz sc-33562 Sec61b Millipore Sigma 07-205 Calnexin BD transduction laboratories, 610523 RPL26 Invitrogen PA5-17093 SFPQ Abcam ab11825 PET117 Thermo Fisher Scientific PA5-61574 COX2 Abcam ab110258 TOM20 Cell Signaling 42406 TIM23 Proteintech 11123-1-AP LAMP-1 Cell Signaling 9091S LAMP-2 Thermo Fisher Scientific MA1-205 HRP rabbit Jackson Immuno Research Laboratories 111-035-003 HRP mouse Jackson Immuno Research Laboratories 115-035-003 Alexa fluor 488 rabbit Life Technologies A11034 Cy3-conjugated goat anti-mouse Jackson Immuno Research Laboratories 115-165-003 Hoechst Millipore Sigma B2261 Chemicals, peptides, and recombinant proteins Protease Inhibitor Cocktail Millipore Sigma P8340 FuGENE HD Transfection Reagent Promega E2311 Lipofectamine RNAiMAX Transfection Reagent Thermo Fisher Scientific 13778075 CCCP Millipore Sigma C2759 Glucose Millipore Sigma G7021 A23187 Millipore Sigma C7522 Cycloheximide Millipore Sigma C7698 Puromycin Millipore Sigma P8833 MitoBloCK-6 Millipore Sigma 5.05759.0001 (Continued on next page) e1 Molecular Cell 82, 2815–2831.e1–e5, August 4, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligomycin A Millipore Sigma 75351 Antimycin A Millipore Sigma A8674 Torin 1 Millipore Sigma 475991 Critical commercial assays Endoplasmic Reticulum isolation kit Millipore Sigma ER0100 CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Deposited Data Proteomic data – ProteomeXchange (jPOST) This paper ProteomeXchange: PXD034231; jPOST: JPST001604 Experimental models: Cell lines Human: HEK293T cells ATCC CRL-3216 Human: HeLa cells ATCC CCL-2 Human: HCT116 cells ATCC CCL-247 Mouse: MEF cells Soares et al. 2013 N/A Experimental models: Organisms/strains Mouse: C57Bl/6 Soares et al. 2013 N/A Oligonucleotides shRNA against RRBP1: CCGGCCTAATGGGAAGA TACCTGATCTCGAGATCAGGTATCTTCCCATTAG GTTTTTG Millipore Sigma TRCN0000117407 shRNA against NLRX1: GAGGAGGACTACTACAACGAT Abdul-Sater et al., 2010 N/A shRNA against PINK1: CGGCTGGAGGAGTATCTGATA Millipore Sigma TRCN0000007101 shRNA scramble sequence: GTGCAGGAGTAGGGCATTTAA Abdul-Sater et al., 2010 N/A siRNA against TOM20 Thermo Fisher Scientific 4392420-s18950 siRNA against TIM23 Thermo Fisher Scientific 4390824-s223113 NLRX1 genotyping FW primer: GGC CCT CTT TTA GCT GTT TCA Soares et al., 2013 N/A NLRX1 genotyping RV primer: CGA TCC CAT TCC CCA TTA TT Soares et al., 2013 N/A Software and algorithms GraphPad Prism 8 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Scaffold 5 Proteome Software https://www.proteomesoftware.com/ products/scaffold-5 ..

    Microscopy:

    Article Title: Bimodal endocytic probe for three-dimensional correlative light and electron microscopy
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-LAMP1 BD Pharmigen Cat# 555798, RRID:AB_396132 Rabbit anti-EEA1 Cell Signaling technology Cat# 3288, RRID:AB_2096811 Mouse anti-CD63 Developmental Studies Hybridoma Bank Cat# h5c6, RRID:AB_528158 Rabbit anti-Mouse ZYMED Cat# 61-6800, RRID:AB_88323 Donkey anti-Mouse Alexa-488 Life Technologies Cat# A-21202, RRID:AB_141607 Goat anti-Mouse Alexa-647 Life Technologies Cat# A-21235, RRID:AB_2535804 Donkey anti-Rabbit Alexa-647 Life Technologies Cat# A-31573, RRID:AB_2536183 Donkey anti-Rabbit Alexa-568 Life Technologies Cat# A10042, RRID:AB_2534017 Donkey anti-Rabbit Alexa-488 Life Technologies Cat# A-21206, RRID:AB_2535792 Protein A – Au conjugate (10 nm) Cell Microscopy Core, UMC Utrecht https://cellbiology-utrecht.nl/products.html Chemicals, peptides, and recombinant proteins fBSA-Au5 Cell Microscopy Core, UMC Utrecht https://cellbiology-utrecht.nl/products.html fBSA-Au10 Cell Microscopy Core, UMC Utrecht https://cellbiology-utrecht.nl/products.html Chloroauric acid trihydrate Merck 1.01582 Tannic Acid Mallinckrodt Pharmaceuticals 1764 Bovine Serum Albumin Sigma-Aldrich A9647 BSA Alexa FluorTM 555 conjugate Invitrogen, ThermoFisher A34786 Protein-A GE Healthcare 17-0872-50 Methylcellulose Sigma-Aldrich M-6385 Paraformaldehyde Sigma-Aldrich 441244 Glutaraldehyde Polysciences 1201 Osmium Tetroxide Electron Microscopy Sciences 19132 Uranylacetate SPI-Chem 02624-AB Embed 812 Electron Microscopy Sciences 14900 Lowicryl HM20 Polysciences 23994 Deposited data Raw and analyzed data This paper N/A Experimental models: Cell lines Human: HeLa cells ATCC CCL-2 Human: U2OS cells ATCC HTB-96 Mouse: Dorsal root ganglion (DRG) neurons Foster et al., 2022 N/A Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Icy De Chaumont et al., 2012 https://icy.bioimageanalysis.org/ ec-CLEM Paul-Gilloteaux et al., 2017 https://icy.bioimageanalysis.org/plugin/ec-clem/ PSA particle size analyzer for ImageJ Ralph Sperling, Institut Català de Nanotecnologia https://github.com/psa-rs/psa-macro ComDet Eugene Katrukha, Utrecht University https://imagej.net/plugins/spots- colocalization-comdet IMOD Mastronarde and Held, 2017 https://bio3d.colorado.edu/imod/ serialEM Mastronarde, 2018 https://bio3d.colorado.edu/SerialEM/index.html Other Electron Microscopy Grids This paper https://cellbiology-utrecht.nl/products.html e1 Cell Reports Methods 2, 100220, May 23, 2022 Article ll OPEN ACCESS ..

    Recombinant:

    Article Title: Bimodal endocytic probe for three-dimensional correlative light and electron microscopy
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-LAMP1 BD Pharmigen Cat# 555798, RRID:AB_396132 Rabbit anti-EEA1 Cell Signaling technology Cat# 3288, RRID:AB_2096811 Mouse anti-CD63 Developmental Studies Hybridoma Bank Cat# h5c6, RRID:AB_528158 Rabbit anti-Mouse ZYMED Cat# 61-6800, RRID:AB_88323 Donkey anti-Mouse Alexa-488 Life Technologies Cat# A-21202, RRID:AB_141607 Goat anti-Mouse Alexa-647 Life Technologies Cat# A-21235, RRID:AB_2535804 Donkey anti-Rabbit Alexa-647 Life Technologies Cat# A-31573, RRID:AB_2536183 Donkey anti-Rabbit Alexa-568 Life Technologies Cat# A10042, RRID:AB_2534017 Donkey anti-Rabbit Alexa-488 Life Technologies Cat# A-21206, RRID:AB_2535792 Protein A – Au conjugate (10 nm) Cell Microscopy Core, UMC Utrecht https://cellbiology-utrecht.nl/products.html Chemicals, peptides, and recombinant proteins fBSA-Au5 Cell Microscopy Core, UMC Utrecht https://cellbiology-utrecht.nl/products.html fBSA-Au10 Cell Microscopy Core, UMC Utrecht https://cellbiology-utrecht.nl/products.html Chloroauric acid trihydrate Merck 1.01582 Tannic Acid Mallinckrodt Pharmaceuticals 1764 Bovine Serum Albumin Sigma-Aldrich A9647 BSA Alexa FluorTM 555 conjugate Invitrogen, ThermoFisher A34786 Protein-A GE Healthcare 17-0872-50 Methylcellulose Sigma-Aldrich M-6385 Paraformaldehyde Sigma-Aldrich 441244 Glutaraldehyde Polysciences 1201 Osmium Tetroxide Electron Microscopy Sciences 19132 Uranylacetate SPI-Chem 02624-AB Embed 812 Electron Microscopy Sciences 14900 Lowicryl HM20 Polysciences 23994 Deposited data Raw and analyzed data This paper N/A Experimental models: Cell lines Human: HeLa cells ATCC CCL-2 Human: U2OS cells ATCC HTB-96 Mouse: Dorsal root ganglion (DRG) neurons Foster et al., 2022 N/A Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Icy De Chaumont et al., 2012 https://icy.bioimageanalysis.org/ ec-CLEM Paul-Gilloteaux et al., 2017 https://icy.bioimageanalysis.org/plugin/ec-clem/ PSA particle size analyzer for ImageJ Ralph Sperling, Institut Català de Nanotecnologia https://github.com/psa-rs/psa-macro ComDet Eugene Katrukha, Utrecht University https://imagej.net/plugins/spots- colocalization-comdet IMOD Mastronarde and Held, 2017 https://bio3d.colorado.edu/imod/ serialEM Mastronarde, 2018 https://bio3d.colorado.edu/SerialEM/index.html Other Electron Microscopy Grids This paper https://cellbiology-utrecht.nl/products.html e1 Cell Reports Methods 2, 100220, May 23, 2022 Article ll OPEN ACCESS ..

    Article Title: Systematic profiling of cytosolic membraneless organelles reveals enrichment of oncogenic mRNA upon oxidative stress.
    Article Snippet: pLX304-Flag-APEX-NES was a gift from Alice Ting (Addgene plasmid #92158; https://www.addgene.org/92158/; RRID: Addgene_92158).82 For DDX6-APEX2 fusion, the backbone of the APEX2-FLAG expression vector was amplified and inserted into a .. REAGENT or RESOURCE SOURCE IDENTIFIER Live Imaging Videos FigShare – This paper https://doi.org/10.6084/m9.figshare.27948777 Western Blot Images FigShare – This paper https://doi.org/10.6084/m9.figshare.27948777 Experimental models: Cell lines Human: HeLa cells ATCC CCL-2 Human: HEK293T cells ATCC CRL-3216 Human: HeLa APEX-FLAG cells This paper N/A Human: HeLa APEX-DDX6 cells This paper N/A Human: HeLa APEX-G3BP cells This paper N/A Human: HeLa G3BP-GFP DDX6-RFP cells This paper N/A Recombinant DNA pLX304-Flag-APEX-NES Alice Ting Addgene plasmid #92158; RRID: Addgene_92158 Phage UbiC tagRFP-DDX6 Jeffrey Chao Addgene plasmid #119947; RRID: Addgene_119947 Phage UbiC G3BP1-GFP-GFP Jeffrey Chao Addgene plasmid #119950; RRID: Addgene_119950 pCAG-HIVgp plasmid Miyoshi et al.67 #RDB04394 pCMV-VSV-G-RSV-Rev plasmid Miyoshi et al.67 #RDB04393 Custom Plasmids – see Table 1 This Paper N/A Software and algorithms FastQC v0.11.9 Andrews68 https://github.com/s-andrews/FastQC Trimmomatic v0.39 Bolger et al.69 https://github.com/usadellab/Trimmomatic Whippet Sterne-Weiler et al.70 https://github.com/timbitz/Whippet.jl DESeq2 v1.36.0 Love et al.71 http://www.bioconductor.org/packages/ release/bioc/html/DESeq2.html gProfiler v4.4.4 Raudvere et al.72 https://biit.cs.ut.ee/gprofiler/gost REVIGO Supek et al.73 http://revigo.irb.hr/ GGplot2 Villanueva et al.74 https://ggplot2.tidyverse.org pheatmap Kolde75 https://github.com/raivokolde/pheatmap IUPred2A Erdos et al.76 https://iupred2a.elte.hu/ Bedtools Quinlan et al.77 https://bedtools.readthedocs.io/en/latest/ statsmodels.stats.multitest Seabold et al.78 https://www.statsmodels.org/dev/generated/ statsmodels.stats.multitest.multipletests.html FiJi v1.53 Schindelin et al.79 https://imagej.net/software/fiji/ CellProfiler v4.2.4 Stirling et al.32 https://github.com/CellProfiler/CellProfiler Ilastik v1.3.3 Berg et al.33 https://www.ilastik.org/download cytominer v0.2.2 Singh et al.80 https://github.com/cytomining/cytominer Morpheus Broad Institute https://software.broadinstitute.org/morpheus JACoP plugin Bolte et al.81 https://imagej.net/plugins/jacop FlowJo BD Life Sciences https://www.flowjo.com Cell Reports 45, 117203, April 28, 2026 17 pcDNA3.1 vector in combination with the DDX6 ORF from phage UbiC tagRFP-DDX6 using the HiFi NEBuilder cloning kit (NEBiolabs) and partially overlapping primers (Table 1). ..

    Article Title: Restriction factor screening identifies RABGAP1L-mediated disruption of endocytosis as a host antiviral defense.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NDV-GFP Adolfo Garcia-Sastre N/A SARS-CoV-2/human/Switzerland/IMV5/ 2020 Busnadiego et al., 2020 N/A Chemicals, peptides, and recombinant proteins Recombinant Human IFN-alpha 2 Protein Novusbio Cat#NBP2-34971 Recombinant Human IFN Beta 1b Pbl assay science Cat#11420-1 Recombinant Human IFN-gamma Protein Novusbio Cat#NBP2-34992 Recombinant Human IL-29/IFN-lambda 1 Protein Novusbio Cat#NBP2-34996 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D8418 Transferrin From Human Serum, Alexa FluorTM 488 Conjugate Thermo Fisher Scientific Cat#T13342 Dynasore Merck Cat#D7693 Lipofectamine RNAiMAX Invitrogen Cat#13778150 OptiMEM Life Technologies Cat#31985062 FuGENE HD transfection reagent Promega Cat#E2311 EnduRenTM Live Cell Substrate Promega Cat#E6482 TPCK-trypsin Sigma-Aldrich Cat#4370285 16% paraformaldehyde Lucerna Chem Cat#EMS15710 Triton X-100 Promega Cat#H5142 ProLong Gold Antifade Mountant Life Technologies Cat#P36930 Airway Epithelial Cell Growth Medium PromoCell Cat#C-21260 Airway Epithelial Cell Growth Medium SupplementPack PromoCell Cat#C-39160 Y-27632 dihydrochloride Selleck Chemicals Cat#1254 FluoroBriteTM DMEM Life Technologies Cat#A1896701 Ammonium chloride Sigma-Aldrich Cat#254134 Saponin Sigma-Aldrich Cat#47036 Bovine serum albumin (BSA) Sigma-Aldrich Cat#A7906 DEAE-dextran hydrochloride Sigma-Aldrich Cat#D9885 CCF2-AM Thermo Fisher Scientific Cat#K1032 Biotin Sigma-Aldrich Cat#B4501-1G cOmpleteTM, Mini Protease Inhibitor Cocktail Roche Cat#11836153001 PhosSTOPTM Roche Cat#4906837001 PierceTM Streptavidin Magnetic Beads Thermo Fisher Scientific Cat#88817 Tris hydrochloride (Tris-HCl) Sigma-Aldrich Cat#10812846001 Potassium chloride (KCl) Sigma-Aldrich Cat#60130 Sodium carbonate (Na2CO3) Sigma-Aldrich Cat#31432 Ammonium bicarbonate (NH4HCO3) Sigma-Aldrich Cat#A6141 Paraformaldehyde Electron Microscopy Sciences Cat#19208 Critical commercial assays SuperScript III reverse transcriptase Thermo Fisher Scientific Cat#18080044 CellTiter-Glo Luminescent Cell Viability Assay Promega Cat#G7570 QuikChange II XL Site-Directed Mutagenesis Kit Agilent Technologies Cat#200522 In-Fusion HD Cloning Plus Kit Takara Cat#638910 ReliaPrepTM RNA Miniprep Systems Promega Cat#Z6012 (Continued on next page) Cell Reports 38, 110549, March 22, 2022 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fast EvaGreen qPCR Master Mix Kit Biotium Cat#31003-1 Dual-Glo Luciferase Assay System Promega Cat#E2980 LIVE/DEADTM Fixable Near-IR Dead Cell Stain Kit Thermo Fisher Scientific Cat#L10119 Deposited data Investigating the interactome of TurboIDtagged RABGAP1L in the presence or absence of IFNa2 by proximity labeling proteomics ProteomeXchange PXD029960 Experimental models: Cell lines Human: lung carcinoma cell line A549 ATCC CCL-185 Human: lung adenocarcinoma cell line Calu-3 ATCC HTB-55 Human: embryonic kidney cell line HEK293T ATCC CRL-11268 Human: HeLa cells ATCC CCL-2 Human: Huh-7 cells Volker Thiel van den Worm et al., 2012 Human: U87-MG cells ATCC HTB-14 MRC-5-hTert Turkington et al., 2015 N/A Human primary bronchial epithelial cell (BEpC) cultures from a 73-year-old female PromoCell Cat#C-12640 Canis familiaris: Madin-Darby Canine Kidney cell line MDCK ATCC CCL-34 Cercopithecus aethiops: Vero-CCL81 cells ATCC CCL-81 Cercopithecus aethiops: Vero-E6 cells ATCC CRL-1586 Oligonucleotides Oligonucleotides (see Tables S1 and S3) This study N/A Recombinant DNA pLVX-RABGAP1L-A-IRES-Puro This study N/A pLVX-RABGAP1L-G-IRES-Puro This study N/A pLVX-RABGAP1L-H-IRES-Puro This study N/A pLVX-RABGAP1L-I-IRES-Puro This study N/A p3xFLAG-RABGAP1L-A This study N/A p3xFLAG-RABGAP1L-421 This study N/A p3xFLAG-mCherry This study N/A p3xFLAG-Mx1 This study N/A pLVX-TurboID-V5-GFP-NES-IRES-Puro Borold et al., 2021 N/A pLVX-TurboID-V5-RABGAP1L-A-IRESPuro This study N/A pLVX-RABGAP1L-delTBC-IRES-Puro This study N/A pLVX-RABGAP1L-421-IRES-Puro This study N/A pLVX-RABGAP1L-340-IRES-Puro This study N/A pLVX-RABGAP1L-257-IRES-Puro This study N/A pLVX-RABGAP1L-R584A-IRES-Puro This study N/A pLVX-RABGAP1L-Q621A-IRES-Puro This study N/A pLVX-RABGAP1L-R584A-Q621A-IRESPuro This study N/A pLVX-RABGAP1L-KK784EE-IRES-Puro This study N/A pCAGGS-WSN/33-PB1 Domingues et al., 2015 N/A pCAGGS-WSN/33-PB2 Domingues et al., 2015 N/A pCAGGS-WSN/33-PA Domingues et al., 2015 N/A (Continued on next page) e3 Cell Reports 38, 110549, March 22, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAGGS-WSN/33-NP Domingues et al., 2015 N/A pPol-I-FFluc Domingues et al., 2015 N/A pRL-SV40 Domingues et al., 2015 N/A pPol-FF-luc-358 Domingues et al., 2015 N/A Software and algorithms IncuCyte ZOOM software (v.2018A) Sartorius https://www.essenbioscience.com/en/ resources/ incucyte-zoom-resources-support/ software-modules-incucyte-zoom/ GraphPad Prism (v.9.1.2) GraphPad Software https://www.graphpad.com/ scientific-software/prism/ LAS X Leica https://www.leica-microsystems.com/de/ produkte/mikroskop-software/p/ leica-las-x-ls/ Image Studio Light (v.5.2)) LI-COR Biosciences https://www.licor.com/bio/ image-studio-lite/ FlowJo (v.10) BD https://www.flowjo.com/solutions/flowjo Imaris (v. 9.7.2) Oxford Instruments https://imaris.oxinst.com/ ImageJ National Institutes of Health, Bethesda, USA https://imagej.nih.gov/ij/ 7300 System SDS Software Core Application (v.1.4) Applied Biosystems N/A SaintExpress algorithm CRAPome https://reprint-apms.org/? q=analysis_front_apms Other 7300 Real-Time PCR System Applied Biosystems N/A EnVision Multimode Microplate Reader PerkinElmer Cat#2105-0010 Odissey Fc imaging system LI-COR Biosciences N/A LEICA SP8 (or SP5) upright confocal laser scanning microscope Leica N/A FACSVerse System BD N/A Leica DMIL LED upright microscope and Leica DFC7000 T camera Leica N/A

    Electron Microscopy:

    Article Title: Bimodal endocytic probe for three-dimensional correlative light and electron microscopy
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-LAMP1 BD Pharmigen Cat# 555798, RRID:AB_396132 Rabbit anti-EEA1 Cell Signaling technology Cat# 3288, RRID:AB_2096811 Mouse anti-CD63 Developmental Studies Hybridoma Bank Cat# h5c6, RRID:AB_528158 Rabbit anti-Mouse ZYMED Cat# 61-6800, RRID:AB_88323 Donkey anti-Mouse Alexa-488 Life Technologies Cat# A-21202, RRID:AB_141607 Goat anti-Mouse Alexa-647 Life Technologies Cat# A-21235, RRID:AB_2535804 Donkey anti-Rabbit Alexa-647 Life Technologies Cat# A-31573, RRID:AB_2536183 Donkey anti-Rabbit Alexa-568 Life Technologies Cat# A10042, RRID:AB_2534017 Donkey anti-Rabbit Alexa-488 Life Technologies Cat# A-21206, RRID:AB_2535792 Protein A – Au conjugate (10 nm) Cell Microscopy Core, UMC Utrecht https://cellbiology-utrecht.nl/products.html Chemicals, peptides, and recombinant proteins fBSA-Au5 Cell Microscopy Core, UMC Utrecht https://cellbiology-utrecht.nl/products.html fBSA-Au10 Cell Microscopy Core, UMC Utrecht https://cellbiology-utrecht.nl/products.html Chloroauric acid trihydrate Merck 1.01582 Tannic Acid Mallinckrodt Pharmaceuticals 1764 Bovine Serum Albumin Sigma-Aldrich A9647 BSA Alexa FluorTM 555 conjugate Invitrogen, ThermoFisher A34786 Protein-A GE Healthcare 17-0872-50 Methylcellulose Sigma-Aldrich M-6385 Paraformaldehyde Sigma-Aldrich 441244 Glutaraldehyde Polysciences 1201 Osmium Tetroxide Electron Microscopy Sciences 19132 Uranylacetate SPI-Chem 02624-AB Embed 812 Electron Microscopy Sciences 14900 Lowicryl HM20 Polysciences 23994 Deposited data Raw and analyzed data This paper N/A Experimental models: Cell lines Human: HeLa cells ATCC CCL-2 Human: U2OS cells ATCC HTB-96 Mouse: Dorsal root ganglion (DRG) neurons Foster et al., 2022 N/A Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Icy De Chaumont et al., 2012 https://icy.bioimageanalysis.org/ ec-CLEM Paul-Gilloteaux et al., 2017 https://icy.bioimageanalysis.org/plugin/ec-clem/ PSA particle size analyzer for ImageJ Ralph Sperling, Institut Català de Nanotecnologia https://github.com/psa-rs/psa-macro ComDet Eugene Katrukha, Utrecht University https://imagej.net/plugins/spots- colocalization-comdet IMOD Mastronarde and Held, 2017 https://bio3d.colorado.edu/imod/ serialEM Mastronarde, 2018 https://bio3d.colorado.edu/SerialEM/index.html Other Electron Microscopy Grids This paper https://cellbiology-utrecht.nl/products.html e1 Cell Reports Methods 2, 100220, May 23, 2022 Article ll OPEN ACCESS ..

    Imaging:

    Article Title: Systematic profiling of cytosolic membraneless organelles reveals enrichment of oncogenic mRNA upon oxidative stress.
    Article Snippet: pLX304-Flag-APEX-NES was a gift from Alice Ting (Addgene plasmid #92158; https://www.addgene.org/92158/; RRID: Addgene_92158).82 For DDX6-APEX2 fusion, the backbone of the APEX2-FLAG expression vector was amplified and inserted into a .. REAGENT or RESOURCE SOURCE IDENTIFIER Live Imaging Videos FigShare – This paper https://doi.org/10.6084/m9.figshare.27948777 Western Blot Images FigShare – This paper https://doi.org/10.6084/m9.figshare.27948777 Experimental models: Cell lines Human: HeLa cells ATCC CCL-2 Human: HEK293T cells ATCC CRL-3216 Human: HeLa APEX-FLAG cells This paper N/A Human: HeLa APEX-DDX6 cells This paper N/A Human: HeLa APEX-G3BP cells This paper N/A Human: HeLa G3BP-GFP DDX6-RFP cells This paper N/A Recombinant DNA pLX304-Flag-APEX-NES Alice Ting Addgene plasmid #92158; RRID: Addgene_92158 Phage UbiC tagRFP-DDX6 Jeffrey Chao Addgene plasmid #119947; RRID: Addgene_119947 Phage UbiC G3BP1-GFP-GFP Jeffrey Chao Addgene plasmid #119950; RRID: Addgene_119950 pCAG-HIVgp plasmid Miyoshi et al.67 #RDB04394 pCMV-VSV-G-RSV-Rev plasmid Miyoshi et al.67 #RDB04393 Custom Plasmids – see Table 1 This Paper N/A Software and algorithms FastQC v0.11.9 Andrews68 https://github.com/s-andrews/FastQC Trimmomatic v0.39 Bolger et al.69 https://github.com/usadellab/Trimmomatic Whippet Sterne-Weiler et al.70 https://github.com/timbitz/Whippet.jl DESeq2 v1.36.0 Love et al.71 http://www.bioconductor.org/packages/ release/bioc/html/DESeq2.html gProfiler v4.4.4 Raudvere et al.72 https://biit.cs.ut.ee/gprofiler/gost REVIGO Supek et al.73 http://revigo.irb.hr/ GGplot2 Villanueva et al.74 https://ggplot2.tidyverse.org pheatmap Kolde75 https://github.com/raivokolde/pheatmap IUPred2A Erdos et al.76 https://iupred2a.elte.hu/ Bedtools Quinlan et al.77 https://bedtools.readthedocs.io/en/latest/ statsmodels.stats.multitest Seabold et al.78 https://www.statsmodels.org/dev/generated/ statsmodels.stats.multitest.multipletests.html FiJi v1.53 Schindelin et al.79 https://imagej.net/software/fiji/ CellProfiler v4.2.4 Stirling et al.32 https://github.com/CellProfiler/CellProfiler Ilastik v1.3.3 Berg et al.33 https://www.ilastik.org/download cytominer v0.2.2 Singh et al.80 https://github.com/cytomining/cytominer Morpheus Broad Institute https://software.broadinstitute.org/morpheus JACoP plugin Bolte et al.81 https://imagej.net/plugins/jacop FlowJo BD Life Sciences https://www.flowjo.com Cell Reports 45, 117203, April 28, 2026 17 pcDNA3.1 vector in combination with the DDX6 ORF from phage UbiC tagRFP-DDX6 using the HiFi NEBuilder cloning kit (NEBiolabs) and partially overlapping primers (Table 1). ..

    Western Blot:

    Article Title: Systematic profiling of cytosolic membraneless organelles reveals enrichment of oncogenic mRNA upon oxidative stress.
    Article Snippet: pLX304-Flag-APEX-NES was a gift from Alice Ting (Addgene plasmid #92158; https://www.addgene.org/92158/; RRID: Addgene_92158).82 For DDX6-APEX2 fusion, the backbone of the APEX2-FLAG expression vector was amplified and inserted into a .. REAGENT or RESOURCE SOURCE IDENTIFIER Live Imaging Videos FigShare – This paper https://doi.org/10.6084/m9.figshare.27948777 Western Blot Images FigShare – This paper https://doi.org/10.6084/m9.figshare.27948777 Experimental models: Cell lines Human: HeLa cells ATCC CCL-2 Human: HEK293T cells ATCC CRL-3216 Human: HeLa APEX-FLAG cells This paper N/A Human: HeLa APEX-DDX6 cells This paper N/A Human: HeLa APEX-G3BP cells This paper N/A Human: HeLa G3BP-GFP DDX6-RFP cells This paper N/A Recombinant DNA pLX304-Flag-APEX-NES Alice Ting Addgene plasmid #92158; RRID: Addgene_92158 Phage UbiC tagRFP-DDX6 Jeffrey Chao Addgene plasmid #119947; RRID: Addgene_119947 Phage UbiC G3BP1-GFP-GFP Jeffrey Chao Addgene plasmid #119950; RRID: Addgene_119950 pCAG-HIVgp plasmid Miyoshi et al.67 #RDB04394 pCMV-VSV-G-RSV-Rev plasmid Miyoshi et al.67 #RDB04393 Custom Plasmids – see Table 1 This Paper N/A Software and algorithms FastQC v0.11.9 Andrews68 https://github.com/s-andrews/FastQC Trimmomatic v0.39 Bolger et al.69 https://github.com/usadellab/Trimmomatic Whippet Sterne-Weiler et al.70 https://github.com/timbitz/Whippet.jl DESeq2 v1.36.0 Love et al.71 http://www.bioconductor.org/packages/ release/bioc/html/DESeq2.html gProfiler v4.4.4 Raudvere et al.72 https://biit.cs.ut.ee/gprofiler/gost REVIGO Supek et al.73 http://revigo.irb.hr/ GGplot2 Villanueva et al.74 https://ggplot2.tidyverse.org pheatmap Kolde75 https://github.com/raivokolde/pheatmap IUPred2A Erdos et al.76 https://iupred2a.elte.hu/ Bedtools Quinlan et al.77 https://bedtools.readthedocs.io/en/latest/ statsmodels.stats.multitest Seabold et al.78 https://www.statsmodels.org/dev/generated/ statsmodels.stats.multitest.multipletests.html FiJi v1.53 Schindelin et al.79 https://imagej.net/software/fiji/ CellProfiler v4.2.4 Stirling et al.32 https://github.com/CellProfiler/CellProfiler Ilastik v1.3.3 Berg et al.33 https://www.ilastik.org/download cytominer v0.2.2 Singh et al.80 https://github.com/cytomining/cytominer Morpheus Broad Institute https://software.broadinstitute.org/morpheus JACoP plugin Bolte et al.81 https://imagej.net/plugins/jacop FlowJo BD Life Sciences https://www.flowjo.com Cell Reports 45, 117203, April 28, 2026 17 pcDNA3.1 vector in combination with the DDX6 ORF from phage UbiC tagRFP-DDX6 using the HiFi NEBuilder cloning kit (NEBiolabs) and partially overlapping primers (Table 1). ..

    Plasmid Preparation:

    Article Title: Systematic profiling of cytosolic membraneless organelles reveals enrichment of oncogenic mRNA upon oxidative stress.
    Article Snippet: pLX304-Flag-APEX-NES was a gift from Alice Ting (Addgene plasmid #92158; https://www.addgene.org/92158/; RRID: Addgene_92158).82 For DDX6-APEX2 fusion, the backbone of the APEX2-FLAG expression vector was amplified and inserted into a .. REAGENT or RESOURCE SOURCE IDENTIFIER Live Imaging Videos FigShare – This paper https://doi.org/10.6084/m9.figshare.27948777 Western Blot Images FigShare – This paper https://doi.org/10.6084/m9.figshare.27948777 Experimental models: Cell lines Human: HeLa cells ATCC CCL-2 Human: HEK293T cells ATCC CRL-3216 Human: HeLa APEX-FLAG cells This paper N/A Human: HeLa APEX-DDX6 cells This paper N/A Human: HeLa APEX-G3BP cells This paper N/A Human: HeLa G3BP-GFP DDX6-RFP cells This paper N/A Recombinant DNA pLX304-Flag-APEX-NES Alice Ting Addgene plasmid #92158; RRID: Addgene_92158 Phage UbiC tagRFP-DDX6 Jeffrey Chao Addgene plasmid #119947; RRID: Addgene_119947 Phage UbiC G3BP1-GFP-GFP Jeffrey Chao Addgene plasmid #119950; RRID: Addgene_119950 pCAG-HIVgp plasmid Miyoshi et al.67 #RDB04394 pCMV-VSV-G-RSV-Rev plasmid Miyoshi et al.67 #RDB04393 Custom Plasmids – see Table 1 This Paper N/A Software and algorithms FastQC v0.11.9 Andrews68 https://github.com/s-andrews/FastQC Trimmomatic v0.39 Bolger et al.69 https://github.com/usadellab/Trimmomatic Whippet Sterne-Weiler et al.70 https://github.com/timbitz/Whippet.jl DESeq2 v1.36.0 Love et al.71 http://www.bioconductor.org/packages/ release/bioc/html/DESeq2.html gProfiler v4.4.4 Raudvere et al.72 https://biit.cs.ut.ee/gprofiler/gost REVIGO Supek et al.73 http://revigo.irb.hr/ GGplot2 Villanueva et al.74 https://ggplot2.tidyverse.org pheatmap Kolde75 https://github.com/raivokolde/pheatmap IUPred2A Erdos et al.76 https://iupred2a.elte.hu/ Bedtools Quinlan et al.77 https://bedtools.readthedocs.io/en/latest/ statsmodels.stats.multitest Seabold et al.78 https://www.statsmodels.org/dev/generated/ statsmodels.stats.multitest.multipletests.html FiJi v1.53 Schindelin et al.79 https://imagej.net/software/fiji/ CellProfiler v4.2.4 Stirling et al.32 https://github.com/CellProfiler/CellProfiler Ilastik v1.3.3 Berg et al.33 https://www.ilastik.org/download cytominer v0.2.2 Singh et al.80 https://github.com/cytomining/cytominer Morpheus Broad Institute https://software.broadinstitute.org/morpheus JACoP plugin Bolte et al.81 https://imagej.net/plugins/jacop FlowJo BD Life Sciences https://www.flowjo.com Cell Reports 45, 117203, April 28, 2026 17 pcDNA3.1 vector in combination with the DDX6 ORF from phage UbiC tagRFP-DDX6 using the HiFi NEBuilder cloning kit (NEBiolabs) and partially overlapping primers (Table 1). ..

    Cloning:

    Article Title: Systematic profiling of cytosolic membraneless organelles reveals enrichment of oncogenic mRNA upon oxidative stress.
    Article Snippet: pLX304-Flag-APEX-NES was a gift from Alice Ting (Addgene plasmid #92158; https://www.addgene.org/92158/; RRID: Addgene_92158).82 For DDX6-APEX2 fusion, the backbone of the APEX2-FLAG expression vector was amplified and inserted into a .. REAGENT or RESOURCE SOURCE IDENTIFIER Live Imaging Videos FigShare – This paper https://doi.org/10.6084/m9.figshare.27948777 Western Blot Images FigShare – This paper https://doi.org/10.6084/m9.figshare.27948777 Experimental models: Cell lines Human: HeLa cells ATCC CCL-2 Human: HEK293T cells ATCC CRL-3216 Human: HeLa APEX-FLAG cells This paper N/A Human: HeLa APEX-DDX6 cells This paper N/A Human: HeLa APEX-G3BP cells This paper N/A Human: HeLa G3BP-GFP DDX6-RFP cells This paper N/A Recombinant DNA pLX304-Flag-APEX-NES Alice Ting Addgene plasmid #92158; RRID: Addgene_92158 Phage UbiC tagRFP-DDX6 Jeffrey Chao Addgene plasmid #119947; RRID: Addgene_119947 Phage UbiC G3BP1-GFP-GFP Jeffrey Chao Addgene plasmid #119950; RRID: Addgene_119950 pCAG-HIVgp plasmid Miyoshi et al.67 #RDB04394 pCMV-VSV-G-RSV-Rev plasmid Miyoshi et al.67 #RDB04393 Custom Plasmids – see Table 1 This Paper N/A Software and algorithms FastQC v0.11.9 Andrews68 https://github.com/s-andrews/FastQC Trimmomatic v0.39 Bolger et al.69 https://github.com/usadellab/Trimmomatic Whippet Sterne-Weiler et al.70 https://github.com/timbitz/Whippet.jl DESeq2 v1.36.0 Love et al.71 http://www.bioconductor.org/packages/ release/bioc/html/DESeq2.html gProfiler v4.4.4 Raudvere et al.72 https://biit.cs.ut.ee/gprofiler/gost REVIGO Supek et al.73 http://revigo.irb.hr/ GGplot2 Villanueva et al.74 https://ggplot2.tidyverse.org pheatmap Kolde75 https://github.com/raivokolde/pheatmap IUPred2A Erdos et al.76 https://iupred2a.elte.hu/ Bedtools Quinlan et al.77 https://bedtools.readthedocs.io/en/latest/ statsmodels.stats.multitest Seabold et al.78 https://www.statsmodels.org/dev/generated/ statsmodels.stats.multitest.multipletests.html FiJi v1.53 Schindelin et al.79 https://imagej.net/software/fiji/ CellProfiler v4.2.4 Stirling et al.32 https://github.com/CellProfiler/CellProfiler Ilastik v1.3.3 Berg et al.33 https://www.ilastik.org/download cytominer v0.2.2 Singh et al.80 https://github.com/cytomining/cytominer Morpheus Broad Institute https://software.broadinstitute.org/morpheus JACoP plugin Bolte et al.81 https://imagej.net/plugins/jacop FlowJo BD Life Sciences https://www.flowjo.com Cell Reports 45, 117203, April 28, 2026 17 pcDNA3.1 vector in combination with the DDX6 ORF from phage UbiC tagRFP-DDX6 using the HiFi NEBuilder cloning kit (NEBiolabs) and partially overlapping primers (Table 1). ..

    Modification:

    Article Title: Shank3 oligomerization governs material properties of the postsynaptic density condensate and synaptic plasticity.
    Article Snippet: Article Shank3 oligomerization governs material properties of the postsynaptic density condensate and synaptic plasticity

    Real-time Polymerase Chain Reaction:

    Article Title: Restriction factor screening identifies RABGAP1L-mediated disruption of endocytosis as a host antiviral defense.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NDV-GFP Adolfo Garcia-Sastre N/A SARS-CoV-2/human/Switzerland/IMV5/ 2020 Busnadiego et al., 2020 N/A Chemicals, peptides, and recombinant proteins Recombinant Human IFN-alpha 2 Protein Novusbio Cat#NBP2-34971 Recombinant Human IFN Beta 1b Pbl assay science Cat#11420-1 Recombinant Human IFN-gamma Protein Novusbio Cat#NBP2-34992 Recombinant Human IL-29/IFN-lambda 1 Protein Novusbio Cat#NBP2-34996 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D8418 Transferrin From Human Serum, Alexa FluorTM 488 Conjugate Thermo Fisher Scientific Cat#T13342 Dynasore Merck Cat#D7693 Lipofectamine RNAiMAX Invitrogen Cat#13778150 OptiMEM Life Technologies Cat#31985062 FuGENE HD transfection reagent Promega Cat#E2311 EnduRenTM Live Cell Substrate Promega Cat#E6482 TPCK-trypsin Sigma-Aldrich Cat#4370285 16% paraformaldehyde Lucerna Chem Cat#EMS15710 Triton X-100 Promega Cat#H5142 ProLong Gold Antifade Mountant Life Technologies Cat#P36930 Airway Epithelial Cell Growth Medium PromoCell Cat#C-21260 Airway Epithelial Cell Growth Medium SupplementPack PromoCell Cat#C-39160 Y-27632 dihydrochloride Selleck Chemicals Cat#1254 FluoroBriteTM DMEM Life Technologies Cat#A1896701 Ammonium chloride Sigma-Aldrich Cat#254134 Saponin Sigma-Aldrich Cat#47036 Bovine serum albumin (BSA) Sigma-Aldrich Cat#A7906 DEAE-dextran hydrochloride Sigma-Aldrich Cat#D9885 CCF2-AM Thermo Fisher Scientific Cat#K1032 Biotin Sigma-Aldrich Cat#B4501-1G cOmpleteTM, Mini Protease Inhibitor Cocktail Roche Cat#11836153001 PhosSTOPTM Roche Cat#4906837001 PierceTM Streptavidin Magnetic Beads Thermo Fisher Scientific Cat#88817 Tris hydrochloride (Tris-HCl) Sigma-Aldrich Cat#10812846001 Potassium chloride (KCl) Sigma-Aldrich Cat#60130 Sodium carbonate (Na2CO3) Sigma-Aldrich Cat#31432 Ammonium bicarbonate (NH4HCO3) Sigma-Aldrich Cat#A6141 Paraformaldehyde Electron Microscopy Sciences Cat#19208 Critical commercial assays SuperScript III reverse transcriptase Thermo Fisher Scientific Cat#18080044 CellTiter-Glo Luminescent Cell Viability Assay Promega Cat#G7570 QuikChange II XL Site-Directed Mutagenesis Kit Agilent Technologies Cat#200522 In-Fusion HD Cloning Plus Kit Takara Cat#638910 ReliaPrepTM RNA Miniprep Systems Promega Cat#Z6012 (Continued on next page) Cell Reports 38, 110549, March 22, 2022 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fast EvaGreen qPCR Master Mix Kit Biotium Cat#31003-1 Dual-Glo Luciferase Assay System Promega Cat#E2980 LIVE/DEADTM Fixable Near-IR Dead Cell Stain Kit Thermo Fisher Scientific Cat#L10119 Deposited data Investigating the interactome of TurboIDtagged RABGAP1L in the presence or absence of IFNa2 by proximity labeling proteomics ProteomeXchange PXD029960 Experimental models: Cell lines Human: lung carcinoma cell line A549 ATCC CCL-185 Human: lung adenocarcinoma cell line Calu-3 ATCC HTB-55 Human: embryonic kidney cell line HEK293T ATCC CRL-11268 Human: HeLa cells ATCC CCL-2 Human: Huh-7 cells Volker Thiel van den Worm et al., 2012 Human: U87-MG cells ATCC HTB-14 MRC-5-hTert Turkington et al., 2015 N/A Human primary bronchial epithelial cell (BEpC) cultures from a 73-year-old female PromoCell Cat#C-12640 Canis familiaris: Madin-Darby Canine Kidney cell line MDCK ATCC CCL-34 Cercopithecus aethiops: Vero-CCL81 cells ATCC CCL-81 Cercopithecus aethiops: Vero-E6 cells ATCC CRL-1586 Oligonucleotides Oligonucleotides (see Tables S1 and S3) This study N/A Recombinant DNA pLVX-RABGAP1L-A-IRES-Puro This study N/A pLVX-RABGAP1L-G-IRES-Puro This study N/A pLVX-RABGAP1L-H-IRES-Puro This study N/A pLVX-RABGAP1L-I-IRES-Puro This study N/A p3xFLAG-RABGAP1L-A This study N/A p3xFLAG-RABGAP1L-421 This study N/A p3xFLAG-mCherry This study N/A p3xFLAG-Mx1 This study N/A pLVX-TurboID-V5-GFP-NES-IRES-Puro Borold et al., 2021 N/A pLVX-TurboID-V5-RABGAP1L-A-IRESPuro This study N/A pLVX-RABGAP1L-delTBC-IRES-Puro This study N/A pLVX-RABGAP1L-421-IRES-Puro This study N/A pLVX-RABGAP1L-340-IRES-Puro This study N/A pLVX-RABGAP1L-257-IRES-Puro This study N/A pLVX-RABGAP1L-R584A-IRES-Puro This study N/A pLVX-RABGAP1L-Q621A-IRES-Puro This study N/A pLVX-RABGAP1L-R584A-Q621A-IRESPuro This study N/A pLVX-RABGAP1L-KK784EE-IRES-Puro This study N/A pCAGGS-WSN/33-PB1 Domingues et al., 2015 N/A pCAGGS-WSN/33-PB2 Domingues et al., 2015 N/A pCAGGS-WSN/33-PA Domingues et al., 2015 N/A (Continued on next page) e3 Cell Reports 38, 110549, March 22, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAGGS-WSN/33-NP Domingues et al., 2015 N/A pPol-I-FFluc Domingues et al., 2015 N/A pRL-SV40 Domingues et al., 2015 N/A pPol-FF-luc-358 Domingues et al., 2015 N/A Software and algorithms IncuCyte ZOOM software (v.2018A) Sartorius https://www.essenbioscience.com/en/ resources/ incucyte-zoom-resources-support/ software-modules-incucyte-zoom/ GraphPad Prism (v.9.1.2) GraphPad Software https://www.graphpad.com/ scientific-software/prism/ LAS X Leica https://www.leica-microsystems.com/de/ produkte/mikroskop-software/p/ leica-las-x-ls/ Image Studio Light (v.5.2)) LI-COR Biosciences https://www.licor.com/bio/ image-studio-lite/ FlowJo (v.10) BD https://www.flowjo.com/solutions/flowjo Imaris (v. 9.7.2) Oxford Instruments https://imaris.oxinst.com/ ImageJ National Institutes of Health, Bethesda, USA https://imagej.nih.gov/ij/ 7300 System SDS Software Core Application (v.1.4) Applied Biosystems N/A SaintExpress algorithm CRAPome https://reprint-apms.org/? q=analysis_front_apms Other 7300 Real-Time PCR System Applied Biosystems N/A EnVision Multimode Microplate Reader PerkinElmer Cat#2105-0010 Odissey Fc imaging system LI-COR Biosciences N/A LEICA SP8 (or SP5) upright confocal laser scanning microscope Leica N/A FACSVerse System BD N/A Leica DMIL LED upright microscope and Leica DFC7000 T camera Leica N/A

    Luciferase:

    Article Title: Restriction factor screening identifies RABGAP1L-mediated disruption of endocytosis as a host antiviral defense.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NDV-GFP Adolfo Garcia-Sastre N/A SARS-CoV-2/human/Switzerland/IMV5/ 2020 Busnadiego et al., 2020 N/A Chemicals, peptides, and recombinant proteins Recombinant Human IFN-alpha 2 Protein Novusbio Cat#NBP2-34971 Recombinant Human IFN Beta 1b Pbl assay science Cat#11420-1 Recombinant Human IFN-gamma Protein Novusbio Cat#NBP2-34992 Recombinant Human IL-29/IFN-lambda 1 Protein Novusbio Cat#NBP2-34996 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D8418 Transferrin From Human Serum, Alexa FluorTM 488 Conjugate Thermo Fisher Scientific Cat#T13342 Dynasore Merck Cat#D7693 Lipofectamine RNAiMAX Invitrogen Cat#13778150 OptiMEM Life Technologies Cat#31985062 FuGENE HD transfection reagent Promega Cat#E2311 EnduRenTM Live Cell Substrate Promega Cat#E6482 TPCK-trypsin Sigma-Aldrich Cat#4370285 16% paraformaldehyde Lucerna Chem Cat#EMS15710 Triton X-100 Promega Cat#H5142 ProLong Gold Antifade Mountant Life Technologies Cat#P36930 Airway Epithelial Cell Growth Medium PromoCell Cat#C-21260 Airway Epithelial Cell Growth Medium SupplementPack PromoCell Cat#C-39160 Y-27632 dihydrochloride Selleck Chemicals Cat#1254 FluoroBriteTM DMEM Life Technologies Cat#A1896701 Ammonium chloride Sigma-Aldrich Cat#254134 Saponin Sigma-Aldrich Cat#47036 Bovine serum albumin (BSA) Sigma-Aldrich Cat#A7906 DEAE-dextran hydrochloride Sigma-Aldrich Cat#D9885 CCF2-AM Thermo Fisher Scientific Cat#K1032 Biotin Sigma-Aldrich Cat#B4501-1G cOmpleteTM, Mini Protease Inhibitor Cocktail Roche Cat#11836153001 PhosSTOPTM Roche Cat#4906837001 PierceTM Streptavidin Magnetic Beads Thermo Fisher Scientific Cat#88817 Tris hydrochloride (Tris-HCl) Sigma-Aldrich Cat#10812846001 Potassium chloride (KCl) Sigma-Aldrich Cat#60130 Sodium carbonate (Na2CO3) Sigma-Aldrich Cat#31432 Ammonium bicarbonate (NH4HCO3) Sigma-Aldrich Cat#A6141 Paraformaldehyde Electron Microscopy Sciences Cat#19208 Critical commercial assays SuperScript III reverse transcriptase Thermo Fisher Scientific Cat#18080044 CellTiter-Glo Luminescent Cell Viability Assay Promega Cat#G7570 QuikChange II XL Site-Directed Mutagenesis Kit Agilent Technologies Cat#200522 In-Fusion HD Cloning Plus Kit Takara Cat#638910 ReliaPrepTM RNA Miniprep Systems Promega Cat#Z6012 (Continued on next page) Cell Reports 38, 110549, March 22, 2022 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fast EvaGreen qPCR Master Mix Kit Biotium Cat#31003-1 Dual-Glo Luciferase Assay System Promega Cat#E2980 LIVE/DEADTM Fixable Near-IR Dead Cell Stain Kit Thermo Fisher Scientific Cat#L10119 Deposited data Investigating the interactome of TurboIDtagged RABGAP1L in the presence or absence of IFNa2 by proximity labeling proteomics ProteomeXchange PXD029960 Experimental models: Cell lines Human: lung carcinoma cell line A549 ATCC CCL-185 Human: lung adenocarcinoma cell line Calu-3 ATCC HTB-55 Human: embryonic kidney cell line HEK293T ATCC CRL-11268 Human: HeLa cells ATCC CCL-2 Human: Huh-7 cells Volker Thiel van den Worm et al., 2012 Human: U87-MG cells ATCC HTB-14 MRC-5-hTert Turkington et al., 2015 N/A Human primary bronchial epithelial cell (BEpC) cultures from a 73-year-old female PromoCell Cat#C-12640 Canis familiaris: Madin-Darby Canine Kidney cell line MDCK ATCC CCL-34 Cercopithecus aethiops: Vero-CCL81 cells ATCC CCL-81 Cercopithecus aethiops: Vero-E6 cells ATCC CRL-1586 Oligonucleotides Oligonucleotides (see Tables S1 and S3) This study N/A Recombinant DNA pLVX-RABGAP1L-A-IRES-Puro This study N/A pLVX-RABGAP1L-G-IRES-Puro This study N/A pLVX-RABGAP1L-H-IRES-Puro This study N/A pLVX-RABGAP1L-I-IRES-Puro This study N/A p3xFLAG-RABGAP1L-A This study N/A p3xFLAG-RABGAP1L-421 This study N/A p3xFLAG-mCherry This study N/A p3xFLAG-Mx1 This study N/A pLVX-TurboID-V5-GFP-NES-IRES-Puro Borold et al., 2021 N/A pLVX-TurboID-V5-RABGAP1L-A-IRESPuro This study N/A pLVX-RABGAP1L-delTBC-IRES-Puro This study N/A pLVX-RABGAP1L-421-IRES-Puro This study N/A pLVX-RABGAP1L-340-IRES-Puro This study N/A pLVX-RABGAP1L-257-IRES-Puro This study N/A pLVX-RABGAP1L-R584A-IRES-Puro This study N/A pLVX-RABGAP1L-Q621A-IRES-Puro This study N/A pLVX-RABGAP1L-R584A-Q621A-IRESPuro This study N/A pLVX-RABGAP1L-KK784EE-IRES-Puro This study N/A pCAGGS-WSN/33-PB1 Domingues et al., 2015 N/A pCAGGS-WSN/33-PB2 Domingues et al., 2015 N/A pCAGGS-WSN/33-PA Domingues et al., 2015 N/A (Continued on next page) e3 Cell Reports 38, 110549, March 22, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAGGS-WSN/33-NP Domingues et al., 2015 N/A pPol-I-FFluc Domingues et al., 2015 N/A pRL-SV40 Domingues et al., 2015 N/A pPol-FF-luc-358 Domingues et al., 2015 N/A Software and algorithms IncuCyte ZOOM software (v.2018A) Sartorius https://www.essenbioscience.com/en/ resources/ incucyte-zoom-resources-support/ software-modules-incucyte-zoom/ GraphPad Prism (v.9.1.2) GraphPad Software https://www.graphpad.com/ scientific-software/prism/ LAS X Leica https://www.leica-microsystems.com/de/ produkte/mikroskop-software/p/ leica-las-x-ls/ Image Studio Light (v.5.2)) LI-COR Biosciences https://www.licor.com/bio/ image-studio-lite/ FlowJo (v.10) BD https://www.flowjo.com/solutions/flowjo Imaris (v. 9.7.2) Oxford Instruments https://imaris.oxinst.com/ ImageJ National Institutes of Health, Bethesda, USA https://imagej.nih.gov/ij/ 7300 System SDS Software Core Application (v.1.4) Applied Biosystems N/A SaintExpress algorithm CRAPome https://reprint-apms.org/? q=analysis_front_apms Other 7300 Real-Time PCR System Applied Biosystems N/A EnVision Multimode Microplate Reader PerkinElmer Cat#2105-0010 Odissey Fc imaging system LI-COR Biosciences N/A LEICA SP8 (or SP5) upright confocal laser scanning microscope Leica N/A FACSVerse System BD N/A Leica DMIL LED upright microscope and Leica DFC7000 T camera Leica N/A

    Staining:

    Article Title: Restriction factor screening identifies RABGAP1L-mediated disruption of endocytosis as a host antiviral defense.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NDV-GFP Adolfo Garcia-Sastre N/A SARS-CoV-2/human/Switzerland/IMV5/ 2020 Busnadiego et al., 2020 N/A Chemicals, peptides, and recombinant proteins Recombinant Human IFN-alpha 2 Protein Novusbio Cat#NBP2-34971 Recombinant Human IFN Beta 1b Pbl assay science Cat#11420-1 Recombinant Human IFN-gamma Protein Novusbio Cat#NBP2-34992 Recombinant Human IL-29/IFN-lambda 1 Protein Novusbio Cat#NBP2-34996 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D8418 Transferrin From Human Serum, Alexa FluorTM 488 Conjugate Thermo Fisher Scientific Cat#T13342 Dynasore Merck Cat#D7693 Lipofectamine RNAiMAX Invitrogen Cat#13778150 OptiMEM Life Technologies Cat#31985062 FuGENE HD transfection reagent Promega Cat#E2311 EnduRenTM Live Cell Substrate Promega Cat#E6482 TPCK-trypsin Sigma-Aldrich Cat#4370285 16% paraformaldehyde Lucerna Chem Cat#EMS15710 Triton X-100 Promega Cat#H5142 ProLong Gold Antifade Mountant Life Technologies Cat#P36930 Airway Epithelial Cell Growth Medium PromoCell Cat#C-21260 Airway Epithelial Cell Growth Medium SupplementPack PromoCell Cat#C-39160 Y-27632 dihydrochloride Selleck Chemicals Cat#1254 FluoroBriteTM DMEM Life Technologies Cat#A1896701 Ammonium chloride Sigma-Aldrich Cat#254134 Saponin Sigma-Aldrich Cat#47036 Bovine serum albumin (BSA) Sigma-Aldrich Cat#A7906 DEAE-dextran hydrochloride Sigma-Aldrich Cat#D9885 CCF2-AM Thermo Fisher Scientific Cat#K1032 Biotin Sigma-Aldrich Cat#B4501-1G cOmpleteTM, Mini Protease Inhibitor Cocktail Roche Cat#11836153001 PhosSTOPTM Roche Cat#4906837001 PierceTM Streptavidin Magnetic Beads Thermo Fisher Scientific Cat#88817 Tris hydrochloride (Tris-HCl) Sigma-Aldrich Cat#10812846001 Potassium chloride (KCl) Sigma-Aldrich Cat#60130 Sodium carbonate (Na2CO3) Sigma-Aldrich Cat#31432 Ammonium bicarbonate (NH4HCO3) Sigma-Aldrich Cat#A6141 Paraformaldehyde Electron Microscopy Sciences Cat#19208 Critical commercial assays SuperScript III reverse transcriptase Thermo Fisher Scientific Cat#18080044 CellTiter-Glo Luminescent Cell Viability Assay Promega Cat#G7570 QuikChange II XL Site-Directed Mutagenesis Kit Agilent Technologies Cat#200522 In-Fusion HD Cloning Plus Kit Takara Cat#638910 ReliaPrepTM RNA Miniprep Systems Promega Cat#Z6012 (Continued on next page) Cell Reports 38, 110549, March 22, 2022 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fast EvaGreen qPCR Master Mix Kit Biotium Cat#31003-1 Dual-Glo Luciferase Assay System Promega Cat#E2980 LIVE/DEADTM Fixable Near-IR Dead Cell Stain Kit Thermo Fisher Scientific Cat#L10119 Deposited data Investigating the interactome of TurboIDtagged RABGAP1L in the presence or absence of IFNa2 by proximity labeling proteomics ProteomeXchange PXD029960 Experimental models: Cell lines Human: lung carcinoma cell line A549 ATCC CCL-185 Human: lung adenocarcinoma cell line Calu-3 ATCC HTB-55 Human: embryonic kidney cell line HEK293T ATCC CRL-11268 Human: HeLa cells ATCC CCL-2 Human: Huh-7 cells Volker Thiel van den Worm et al., 2012 Human: U87-MG cells ATCC HTB-14 MRC-5-hTert Turkington et al., 2015 N/A Human primary bronchial epithelial cell (BEpC) cultures from a 73-year-old female PromoCell Cat#C-12640 Canis familiaris: Madin-Darby Canine Kidney cell line MDCK ATCC CCL-34 Cercopithecus aethiops: Vero-CCL81 cells ATCC CCL-81 Cercopithecus aethiops: Vero-E6 cells ATCC CRL-1586 Oligonucleotides Oligonucleotides (see Tables S1 and S3) This study N/A Recombinant DNA pLVX-RABGAP1L-A-IRES-Puro This study N/A pLVX-RABGAP1L-G-IRES-Puro This study N/A pLVX-RABGAP1L-H-IRES-Puro This study N/A pLVX-RABGAP1L-I-IRES-Puro This study N/A p3xFLAG-RABGAP1L-A This study N/A p3xFLAG-RABGAP1L-421 This study N/A p3xFLAG-mCherry This study N/A p3xFLAG-Mx1 This study N/A pLVX-TurboID-V5-GFP-NES-IRES-Puro Borold et al., 2021 N/A pLVX-TurboID-V5-RABGAP1L-A-IRESPuro This study N/A pLVX-RABGAP1L-delTBC-IRES-Puro This study N/A pLVX-RABGAP1L-421-IRES-Puro This study N/A pLVX-RABGAP1L-340-IRES-Puro This study N/A pLVX-RABGAP1L-257-IRES-Puro This study N/A pLVX-RABGAP1L-R584A-IRES-Puro This study N/A pLVX-RABGAP1L-Q621A-IRES-Puro This study N/A pLVX-RABGAP1L-R584A-Q621A-IRESPuro This study N/A pLVX-RABGAP1L-KK784EE-IRES-Puro This study N/A pCAGGS-WSN/33-PB1 Domingues et al., 2015 N/A pCAGGS-WSN/33-PB2 Domingues et al., 2015 N/A pCAGGS-WSN/33-PA Domingues et al., 2015 N/A (Continued on next page) e3 Cell Reports 38, 110549, March 22, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAGGS-WSN/33-NP Domingues et al., 2015 N/A pPol-I-FFluc Domingues et al., 2015 N/A pRL-SV40 Domingues et al., 2015 N/A pPol-FF-luc-358 Domingues et al., 2015 N/A Software and algorithms IncuCyte ZOOM software (v.2018A) Sartorius https://www.essenbioscience.com/en/ resources/ incucyte-zoom-resources-support/ software-modules-incucyte-zoom/ GraphPad Prism (v.9.1.2) GraphPad Software https://www.graphpad.com/ scientific-software/prism/ LAS X Leica https://www.leica-microsystems.com/de/ produkte/mikroskop-software/p/ leica-las-x-ls/ Image Studio Light (v.5.2)) LI-COR Biosciences https://www.licor.com/bio/ image-studio-lite/ FlowJo (v.10) BD https://www.flowjo.com/solutions/flowjo Imaris (v. 9.7.2) Oxford Instruments https://imaris.oxinst.com/ ImageJ National Institutes of Health, Bethesda, USA https://imagej.nih.gov/ij/ 7300 System SDS Software Core Application (v.1.4) Applied Biosystems N/A SaintExpress algorithm CRAPome https://reprint-apms.org/? q=analysis_front_apms Other 7300 Real-Time PCR System Applied Biosystems N/A EnVision Multimode Microplate Reader PerkinElmer Cat#2105-0010 Odissey Fc imaging system LI-COR Biosciences N/A LEICA SP8 (or SP5) upright confocal laser scanning microscope Leica N/A FACSVerse System BD N/A Leica DMIL LED upright microscope and Leica DFC7000 T camera Leica N/A

    Labeling:

    Article Title: Restriction factor screening identifies RABGAP1L-mediated disruption of endocytosis as a host antiviral defense.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NDV-GFP Adolfo Garcia-Sastre N/A SARS-CoV-2/human/Switzerland/IMV5/ 2020 Busnadiego et al., 2020 N/A Chemicals, peptides, and recombinant proteins Recombinant Human IFN-alpha 2 Protein Novusbio Cat#NBP2-34971 Recombinant Human IFN Beta 1b Pbl assay science Cat#11420-1 Recombinant Human IFN-gamma Protein Novusbio Cat#NBP2-34992 Recombinant Human IL-29/IFN-lambda 1 Protein Novusbio Cat#NBP2-34996 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D8418 Transferrin From Human Serum, Alexa FluorTM 488 Conjugate Thermo Fisher Scientific Cat#T13342 Dynasore Merck Cat#D7693 Lipofectamine RNAiMAX Invitrogen Cat#13778150 OptiMEM Life Technologies Cat#31985062 FuGENE HD transfection reagent Promega Cat#E2311 EnduRenTM Live Cell Substrate Promega Cat#E6482 TPCK-trypsin Sigma-Aldrich Cat#4370285 16% paraformaldehyde Lucerna Chem Cat#EMS15710 Triton X-100 Promega Cat#H5142 ProLong Gold Antifade Mountant Life Technologies Cat#P36930 Airway Epithelial Cell Growth Medium PromoCell Cat#C-21260 Airway Epithelial Cell Growth Medium SupplementPack PromoCell Cat#C-39160 Y-27632 dihydrochloride Selleck Chemicals Cat#1254 FluoroBriteTM DMEM Life Technologies Cat#A1896701 Ammonium chloride Sigma-Aldrich Cat#254134 Saponin Sigma-Aldrich Cat#47036 Bovine serum albumin (BSA) Sigma-Aldrich Cat#A7906 DEAE-dextran hydrochloride Sigma-Aldrich Cat#D9885 CCF2-AM Thermo Fisher Scientific Cat#K1032 Biotin Sigma-Aldrich Cat#B4501-1G cOmpleteTM, Mini Protease Inhibitor Cocktail Roche Cat#11836153001 PhosSTOPTM Roche Cat#4906837001 PierceTM Streptavidin Magnetic Beads Thermo Fisher Scientific Cat#88817 Tris hydrochloride (Tris-HCl) Sigma-Aldrich Cat#10812846001 Potassium chloride (KCl) Sigma-Aldrich Cat#60130 Sodium carbonate (Na2CO3) Sigma-Aldrich Cat#31432 Ammonium bicarbonate (NH4HCO3) Sigma-Aldrich Cat#A6141 Paraformaldehyde Electron Microscopy Sciences Cat#19208 Critical commercial assays SuperScript III reverse transcriptase Thermo Fisher Scientific Cat#18080044 CellTiter-Glo Luminescent Cell Viability Assay Promega Cat#G7570 QuikChange II XL Site-Directed Mutagenesis Kit Agilent Technologies Cat#200522 In-Fusion HD Cloning Plus Kit Takara Cat#638910 ReliaPrepTM RNA Miniprep Systems Promega Cat#Z6012 (Continued on next page) Cell Reports 38, 110549, March 22, 2022 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fast EvaGreen qPCR Master Mix Kit Biotium Cat#31003-1 Dual-Glo Luciferase Assay System Promega Cat#E2980 LIVE/DEADTM Fixable Near-IR Dead Cell Stain Kit Thermo Fisher Scientific Cat#L10119 Deposited data Investigating the interactome of TurboIDtagged RABGAP1L in the presence or absence of IFNa2 by proximity labeling proteomics ProteomeXchange PXD029960 Experimental models: Cell lines Human: lung carcinoma cell line A549 ATCC CCL-185 Human: lung adenocarcinoma cell line Calu-3 ATCC HTB-55 Human: embryonic kidney cell line HEK293T ATCC CRL-11268 Human: HeLa cells ATCC CCL-2 Human: Huh-7 cells Volker Thiel van den Worm et al., 2012 Human: U87-MG cells ATCC HTB-14 MRC-5-hTert Turkington et al., 2015 N/A Human primary bronchial epithelial cell (BEpC) cultures from a 73-year-old female PromoCell Cat#C-12640 Canis familiaris: Madin-Darby Canine Kidney cell line MDCK ATCC CCL-34 Cercopithecus aethiops: Vero-CCL81 cells ATCC CCL-81 Cercopithecus aethiops: Vero-E6 cells ATCC CRL-1586 Oligonucleotides Oligonucleotides (see Tables S1 and S3) This study N/A Recombinant DNA pLVX-RABGAP1L-A-IRES-Puro This study N/A pLVX-RABGAP1L-G-IRES-Puro This study N/A pLVX-RABGAP1L-H-IRES-Puro This study N/A pLVX-RABGAP1L-I-IRES-Puro This study N/A p3xFLAG-RABGAP1L-A This study N/A p3xFLAG-RABGAP1L-421 This study N/A p3xFLAG-mCherry This study N/A p3xFLAG-Mx1 This study N/A pLVX-TurboID-V5-GFP-NES-IRES-Puro Borold et al., 2021 N/A pLVX-TurboID-V5-RABGAP1L-A-IRESPuro This study N/A pLVX-RABGAP1L-delTBC-IRES-Puro This study N/A pLVX-RABGAP1L-421-IRES-Puro This study N/A pLVX-RABGAP1L-340-IRES-Puro This study N/A pLVX-RABGAP1L-257-IRES-Puro This study N/A pLVX-RABGAP1L-R584A-IRES-Puro This study N/A pLVX-RABGAP1L-Q621A-IRES-Puro This study N/A pLVX-RABGAP1L-R584A-Q621A-IRESPuro This study N/A pLVX-RABGAP1L-KK784EE-IRES-Puro This study N/A pCAGGS-WSN/33-PB1 Domingues et al., 2015 N/A pCAGGS-WSN/33-PB2 Domingues et al., 2015 N/A pCAGGS-WSN/33-PA Domingues et al., 2015 N/A (Continued on next page) e3 Cell Reports 38, 110549, March 22, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAGGS-WSN/33-NP Domingues et al., 2015 N/A pPol-I-FFluc Domingues et al., 2015 N/A pRL-SV40 Domingues et al., 2015 N/A pPol-FF-luc-358 Domingues et al., 2015 N/A Software and algorithms IncuCyte ZOOM software (v.2018A) Sartorius https://www.essenbioscience.com/en/ resources/ incucyte-zoom-resources-support/ software-modules-incucyte-zoom/ GraphPad Prism (v.9.1.2) GraphPad Software https://www.graphpad.com/ scientific-software/prism/ LAS X Leica https://www.leica-microsystems.com/de/ produkte/mikroskop-software/p/ leica-las-x-ls/ Image Studio Light (v.5.2)) LI-COR Biosciences https://www.licor.com/bio/ image-studio-lite/ FlowJo (v.10) BD https://www.flowjo.com/solutions/flowjo Imaris (v. 9.7.2) Oxford Instruments https://imaris.oxinst.com/ ImageJ National Institutes of Health, Bethesda, USA https://imagej.nih.gov/ij/ 7300 System SDS Software Core Application (v.1.4) Applied Biosystems N/A SaintExpress algorithm CRAPome https://reprint-apms.org/? q=analysis_front_apms Other 7300 Real-Time PCR System Applied Biosystems N/A EnVision Multimode Microplate Reader PerkinElmer Cat#2105-0010 Odissey Fc imaging system LI-COR Biosciences N/A LEICA SP8 (or SP5) upright confocal laser scanning microscope Leica N/A FACSVerse System BD N/A Leica DMIL LED upright microscope and Leica DFC7000 T camera Leica N/A



    Similar Products

    99
    ATCC cell lines human hela atcc ccl
    Cell Lines Human Hela Atcc Ccl, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hela+cells+atcc+ccl+2+human/HeLa/pm42259291-291-140-144
    Average 99 stars, based on 1 article reviews
    cell lines human hela atcc ccl - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC hela cells atcc ccl 2 human
    Hela Cells Atcc Ccl 2 Human, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hela+cells+atcc+ccl+2+human/HeLa/pm41936051-313-26-28
    Average 99 stars, based on 1 article reviews
    hela cells atcc ccl 2 human - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines hela atcc rrid cvcl 0030 human mesenchymal stem cells gonçalves et
    Cell Lines Hela Atcc Rrid Cvcl 0030 Human Mesenchymal Stem Cells Gonçalves Et, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hela+cells+atcc+ccl+2+human/HeLa/pm41933972-266-139-142
    Average 99 stars, based on 1 article reviews
    cell lines hela atcc rrid cvcl 0030 human mesenchymal stem cells gonçalves et - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC human cervical carcinoma cells
    Human Cervical Carcinoma Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hela+cells+atcc+ccl+2+human/HeLa%3B+Cervical+Adenocarcinoma%3B+Human/us12577322-624-22-29
    Average 99 stars, based on 1 article reviews
    human cervical carcinoma cells - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC hela cells
    Inhibition of branched actin leads to increased endosome size. (A-J) . <t>HeLa</t> <t>cells</t> were ( A-C ) untreated, ( D-E ) treated with the formin inhibitor SMIFH2 (25 µM), ( F-G ) treated with the inactive control CK-689 (300 µM), or ( H-J ) the ARP2/3 branched actin inhibitor CK-666 (300 µM) for 50 min. Cells were fixed and stained with EEA1 and cortactin. Merged images (panels C and J ) show decreased cortactin at endosomes upon CK-666 treatment. (K) . Quantification of the effects of the inhibitors on endosome size as depicted in A-J. Imaris software was used to render EEA1-decorated endosomes as surfaces, and endosome size for each treatment (µm 2 ) was normalized to the average endosome size of the untreated group. Quantification represents 30 images from three independent experiments, including ∼50,000 endosomes per treatment. A two-tailed Mann-Whitney nonparametric test was used to determine p -values between treatment groups.
    Hela Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hela+cells+atcc+ccl+2+human/HeLa%3B+Cervical+Adenocarcinoma%3B+Human/bio_rxiv__64898__2026__03__10__710749-177-0-2
    Average 99 stars, based on 1 article reviews
    hela cells - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC hela cell line
    Inhibition of branched actin leads to increased endosome size. (A-J) . <t>HeLa</t> <t>cells</t> were ( A-C ) untreated, ( D-E ) treated with the formin inhibitor SMIFH2 (25 µM), ( F-G ) treated with the inactive control CK-689 (300 µM), or ( H-J ) the ARP2/3 branched actin inhibitor CK-666 (300 µM) for 50 min. Cells were fixed and stained with EEA1 and cortactin. Merged images (panels C and J ) show decreased cortactin at endosomes upon CK-666 treatment. (K) . Quantification of the effects of the inhibitors on endosome size as depicted in A-J. Imaris software was used to render EEA1-decorated endosomes as surfaces, and endosome size for each treatment (µm 2 ) was normalized to the average endosome size of the untreated group. Quantification represents 30 images from three independent experiments, including ∼50,000 endosomes per treatment. A two-tailed Mann-Whitney nonparametric test was used to determine p -values between treatment groups.
    Hela Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hela+cells+atcc+ccl+2+human/HeLa%3B+Cervical+Adenocarcinoma%3B+Human/pm41797580-68-1-4
    Average 99 stars, based on 1 article reviews
    hela cell line - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    97
    ATCC hela cat no ccl 2 cells
    Inhibition of branched actin leads to increased endosome size. (A-J) . <t>HeLa</t> <t>cells</t> were ( A-C ) untreated, ( D-E ) treated with the formin inhibitor SMIFH2 (25 µM), ( F-G ) treated with the inactive control CK-689 (300 µM), or ( H-J ) the ARP2/3 branched actin inhibitor CK-666 (300 µM) for 50 min. Cells were fixed and stained with EEA1 and cortactin. Merged images (panels C and J ) show decreased cortactin at endosomes upon CK-666 treatment. (K) . Quantification of the effects of the inhibitors on endosome size as depicted in A-J. Imaris software was used to render EEA1-decorated endosomes as surfaces, and endosome size for each treatment (µm 2 ) was normalized to the average endosome size of the untreated group. Quantification represents 30 images from three independent experiments, including ∼50,000 endosomes per treatment. A two-tailed Mann-Whitney nonparametric test was used to determine p -values between treatment groups.
    Hela Cat No Ccl 2 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hela+cells+atcc+ccl+2+human/HCT+116%3B+Colon+Carcinoma%3B+Human/pm41744705-49-6-14
    Average 97 stars, based on 1 article reviews
    hela cat no ccl 2 cells - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    99
    ATCC hela ccl 2 cells
    Inhibition of branched actin leads to increased endosome size. (A-J) . <t>HeLa</t> <t>cells</t> were ( A-C ) untreated, ( D-E ) treated with the formin inhibitor SMIFH2 (25 µM), ( F-G ) treated with the inactive control CK-689 (300 µM), or ( H-J ) the ARP2/3 branched actin inhibitor CK-666 (300 µM) for 50 min. Cells were fixed and stained with EEA1 and cortactin. Merged images (panels C and J ) show decreased cortactin at endosomes upon CK-666 treatment. (K) . Quantification of the effects of the inhibitors on endosome size as depicted in A-J. Imaris software was used to render EEA1-decorated endosomes as surfaces, and endosome size for each treatment (µm 2 ) was normalized to the average endosome size of the untreated group. Quantification represents 30 images from three independent experiments, including ∼50,000 endosomes per treatment. A two-tailed Mann-Whitney nonparametric test was used to determine p -values between treatment groups.
    Hela Ccl 2 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hela+cells+atcc+ccl+2+human/Hs888Lu%3B+Lung+Fibroblast%3B+Human/pm41760807-512-0-6
    Average 99 stars, based on 1 article reviews
    hela ccl 2 cells - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    Inhibition of branched actin leads to increased endosome size. (A-J) . HeLa cells were ( A-C ) untreated, ( D-E ) treated with the formin inhibitor SMIFH2 (25 µM), ( F-G ) treated with the inactive control CK-689 (300 µM), or ( H-J ) the ARP2/3 branched actin inhibitor CK-666 (300 µM) for 50 min. Cells were fixed and stained with EEA1 and cortactin. Merged images (panels C and J ) show decreased cortactin at endosomes upon CK-666 treatment. (K) . Quantification of the effects of the inhibitors on endosome size as depicted in A-J. Imaris software was used to render EEA1-decorated endosomes as surfaces, and endosome size for each treatment (µm 2 ) was normalized to the average endosome size of the untreated group. Quantification represents 30 images from three independent experiments, including ∼50,000 endosomes per treatment. A two-tailed Mann-Whitney nonparametric test was used to determine p -values between treatment groups.

    Journal: bioRxiv

    Article Title: Branched actin constrains endosomal cargo to control sorting and fission

    doi: 10.64898/2026.03.10.710749

    Figure Lengend Snippet: Inhibition of branched actin leads to increased endosome size. (A-J) . HeLa cells were ( A-C ) untreated, ( D-E ) treated with the formin inhibitor SMIFH2 (25 µM), ( F-G ) treated with the inactive control CK-689 (300 µM), or ( H-J ) the ARP2/3 branched actin inhibitor CK-666 (300 µM) for 50 min. Cells were fixed and stained with EEA1 and cortactin. Merged images (panels C and J ) show decreased cortactin at endosomes upon CK-666 treatment. (K) . Quantification of the effects of the inhibitors on endosome size as depicted in A-J. Imaris software was used to render EEA1-decorated endosomes as surfaces, and endosome size for each treatment (µm 2 ) was normalized to the average endosome size of the untreated group. Quantification represents 30 images from three independent experiments, including ∼50,000 endosomes per treatment. A two-tailed Mann-Whitney nonparametric test was used to determine p -values between treatment groups.

    Article Snippet: HeLa cells (ATCC-CCL-2) were cultured with complete DMEM (high glucose) (ThermoFisher Scientific, Carlsbad, CA) containing 10% fetal bovine serum (FBS) (Sigma-Aldrich), 1× penicillin-streptomycin, 100 μg/mL Normicin, and 2 mM L-glutamine at 37°C in a humidified incubator with 5% CO2.

    Techniques: Inhibition, Control, Staining, Software, Two Tailed Test, MANN-WHITNEY

    Transferrin recycling is impaired upon ARP2/3 inhibition. (A-D) . HeLa cells on coverslips were incubated with fluorophore-labeled transferrin (Tf-488) for 10 minutes of uptake. Cells were ( A ) untreated, ( B ) treated with 25 µM SMIFH2, ( C ) treated with 300 µM CK-689, or ( D ) treated with 300 µM CK-666 during the transferrin uptake. Images are representative of a treated coverslip after uptake. (E-H) . Cells were chased in ( E ) complete media, ( F ) complete media containing 25 µM SMIFH2, ( G ) complete media containing 300 µM CK-689, or ( H ) complete media containing 300 µM CK-666 for 40 minutes to allow recycling. Images are representative of cells on an treated coverslip after chase. (I) . The arithmetic mean intensity of each image was analyzed using Zeiss Zen Blue software after uptake and chase. For each treatment condition, the internalized mean for the uptake was set at 100%, and the arithmetic mean intensity for each recycling image was expressed as a percentage of the normalized uptake for that condition. Quantification represents 30 images from three independent experiments. Statistical significance was determined using a two-tailed unpaired t -test.

    Journal: bioRxiv

    Article Title: Branched actin constrains endosomal cargo to control sorting and fission

    doi: 10.64898/2026.03.10.710749

    Figure Lengend Snippet: Transferrin recycling is impaired upon ARP2/3 inhibition. (A-D) . HeLa cells on coverslips were incubated with fluorophore-labeled transferrin (Tf-488) for 10 minutes of uptake. Cells were ( A ) untreated, ( B ) treated with 25 µM SMIFH2, ( C ) treated with 300 µM CK-689, or ( D ) treated with 300 µM CK-666 during the transferrin uptake. Images are representative of a treated coverslip after uptake. (E-H) . Cells were chased in ( E ) complete media, ( F ) complete media containing 25 µM SMIFH2, ( G ) complete media containing 300 µM CK-689, or ( H ) complete media containing 300 µM CK-666 for 40 minutes to allow recycling. Images are representative of cells on an treated coverslip after chase. (I) . The arithmetic mean intensity of each image was analyzed using Zeiss Zen Blue software after uptake and chase. For each treatment condition, the internalized mean for the uptake was set at 100%, and the arithmetic mean intensity for each recycling image was expressed as a percentage of the normalized uptake for that condition. Quantification represents 30 images from three independent experiments. Statistical significance was determined using a two-tailed unpaired t -test.

    Article Snippet: HeLa cells (ATCC-CCL-2) were cultured with complete DMEM (high glucose) (ThermoFisher Scientific, Carlsbad, CA) containing 10% fetal bovine serum (FBS) (Sigma-Aldrich), 1× penicillin-streptomycin, 100 μg/mL Normicin, and 2 mM L-glutamine at 37°C in a humidified incubator with 5% CO2.

    Techniques: Inhibition, Incubation, Labeling, Software, Two Tailed Test

    Transferrin and EGF are delayed at early endosomes upon ARP2/3 inhibition. (A-D) . HeLa cells were incubated with Tf-488 diluted in complete media for 10 min. Following uptake, cells were chased in ( A-B ) complete media or ( C-D ) in media containing 300 µM CK-666. Representative images are from the 30 min chase time point. (E). The percentage of Tf-488 fluorescence in EEA1 endosomes was calculated by measuring the area of Tf-EEA1 overlap as a percentage of total Tf fluorescence area. Statistical analysis was performed between the untreated and CK-666-treated groups at each time point. Quantification represents 24 images from three independent experiments. Statistical significance for the 30 min and 45 min time points was determined using a two-tailed Mann-Whitney nonparametric test, and an unpaired two-tailed t -test was used for the 15 min time point. (F). A bar graph showing the individual data points from the 30 min time point in ( E ). (G-J) . HeLa cells were serum starved for 1 h, then incubated with EGF-488 diluted in complete media for 10 min. Following uptake, cells were chased in ( G-H ) complete media or ( I-J ) in complete media containing 300 µM CK-666. Representative images are from the 45 min time point of media chase. (K). The percentage of EGF-488 fluorescence in EEA1-marked endosomes was calculated by measuring the area of EGF-EEA1 overlap as a percentage of total EGF fluorescence area. Statistical analysis was performed between the untreated and CK-666-treated groups at each time point. Quantification represents 24 images from three independent experiments. Statistical significance for the 15 min and 45 min time points was determined using a two-tailed Mann-Whitney nonparametric test, and an unpaired two-tailed t -test was used for the 30 min time point. (L). A bar graph showing the individual data points from the 45 min time point in ( K ).

    Journal: bioRxiv

    Article Title: Branched actin constrains endosomal cargo to control sorting and fission

    doi: 10.64898/2026.03.10.710749

    Figure Lengend Snippet: Transferrin and EGF are delayed at early endosomes upon ARP2/3 inhibition. (A-D) . HeLa cells were incubated with Tf-488 diluted in complete media for 10 min. Following uptake, cells were chased in ( A-B ) complete media or ( C-D ) in media containing 300 µM CK-666. Representative images are from the 30 min chase time point. (E). The percentage of Tf-488 fluorescence in EEA1 endosomes was calculated by measuring the area of Tf-EEA1 overlap as a percentage of total Tf fluorescence area. Statistical analysis was performed between the untreated and CK-666-treated groups at each time point. Quantification represents 24 images from three independent experiments. Statistical significance for the 30 min and 45 min time points was determined using a two-tailed Mann-Whitney nonparametric test, and an unpaired two-tailed t -test was used for the 15 min time point. (F). A bar graph showing the individual data points from the 30 min time point in ( E ). (G-J) . HeLa cells were serum starved for 1 h, then incubated with EGF-488 diluted in complete media for 10 min. Following uptake, cells were chased in ( G-H ) complete media or ( I-J ) in complete media containing 300 µM CK-666. Representative images are from the 45 min time point of media chase. (K). The percentage of EGF-488 fluorescence in EEA1-marked endosomes was calculated by measuring the area of EGF-EEA1 overlap as a percentage of total EGF fluorescence area. Statistical analysis was performed between the untreated and CK-666-treated groups at each time point. Quantification represents 24 images from three independent experiments. Statistical significance for the 15 min and 45 min time points was determined using a two-tailed Mann-Whitney nonparametric test, and an unpaired two-tailed t -test was used for the 30 min time point. (L). A bar graph showing the individual data points from the 45 min time point in ( K ).

    Article Snippet: HeLa cells (ATCC-CCL-2) were cultured with complete DMEM (high glucose) (ThermoFisher Scientific, Carlsbad, CA) containing 10% fetal bovine serum (FBS) (Sigma-Aldrich), 1× penicillin-streptomycin, 100 μg/mL Normicin, and 2 mM L-glutamine at 37°C in a humidified incubator with 5% CO2.

    Techniques: Inhibition, Incubation, Fluorescence, Two Tailed Test, MANN-WHITNEY

    Branched actin inhibition, but not formin inhibition, decreases actin at RAB5 QL endosomes. (A-P) . HeLa cells were transfected with mCherry-RAB5 Q79L and were either ( A-D ) untreated or treated with ( E-H ) 25 µM SMIFH2, ( I-L ) 300 µM CK-689, or ( M-P ) 300 µM CK-666 for 20 min. Cells were fixed and co-stained with cortactin and phalloidin to visualize the actin network. (Q) . Quantification of ( A-P ). RAB5 Q79L endosomes that colocalized with phalloidin or cortactin were counted as a percentage of total RAB5 Q79L endosomes. Quantification represents 15 images from three independent experiments. A two-tailed Mann-Whitney nonparametric test was used to determine significance between treatment groups. Data comparisons without error bars are not significant ( p > 0.05).

    Journal: bioRxiv

    Article Title: Branched actin constrains endosomal cargo to control sorting and fission

    doi: 10.64898/2026.03.10.710749

    Figure Lengend Snippet: Branched actin inhibition, but not formin inhibition, decreases actin at RAB5 QL endosomes. (A-P) . HeLa cells were transfected with mCherry-RAB5 Q79L and were either ( A-D ) untreated or treated with ( E-H ) 25 µM SMIFH2, ( I-L ) 300 µM CK-689, or ( M-P ) 300 µM CK-666 for 20 min. Cells were fixed and co-stained with cortactin and phalloidin to visualize the actin network. (Q) . Quantification of ( A-P ). RAB5 Q79L endosomes that colocalized with phalloidin or cortactin were counted as a percentage of total RAB5 Q79L endosomes. Quantification represents 15 images from three independent experiments. A two-tailed Mann-Whitney nonparametric test was used to determine significance between treatment groups. Data comparisons without error bars are not significant ( p > 0.05).

    Article Snippet: HeLa cells (ATCC-CCL-2) were cultured with complete DMEM (high glucose) (ThermoFisher Scientific, Carlsbad, CA) containing 10% fetal bovine serum (FBS) (Sigma-Aldrich), 1× penicillin-streptomycin, 100 μg/mL Normicin, and 2 mM L-glutamine at 37°C in a humidified incubator with 5% CO2.

    Techniques: Inhibition, Transfection, Staining, Two Tailed Test, MANN-WHITNEY

    Transferrin is bounded by cortactin at endosomes. (A-L) . HeLa cells were transfected with mCherry-RAB5 Q79L and were incubated with ( A-C ) no inhibitor, ( D-F ) 25 µM SMIFH2, ( G-I ) 300 µM CK-689, or ( J-L ) 300 µM CK-666 for 4 min. Following the pre-treatment, cells were incubated with Tf-488 (and their respective inhibitor) for 6 min of uptake. (M-P) . Representative fluorescence intensity profiles of endosomes from ( M ) untreated, ( N ) SMIFH2-treated cells, ( O ) CK-689-treated cells, or ( P ) CK-666-treated cells. The intensity profile of Tf is in green, and the intensity profile of cortactin is in magenta. Tf vertices above 130% that occur within 20 degrees of a cortactin value above 130% are represented with a red circle; these peaks are “bounded”. Tf vertices above 130% that are not within 20 degrees of a cortactin value above 130% are represented with a grey circle and are “not bounded”. (Q). The percentage of “bounded” Tf peaks was quantified from fluorescence intensity profiles (as represented in ( M-P )). Quantification is from three independent experiments, and from 37 endosomes for the untreated group, 43 endosomes for SMIFH2-treated, 38 endosomes for CK-689-treated, and 37 endosomes from the CK-666-treated group. Statistical significance was determined using a two-tailed unpaired t -test (ns: p > 0.05). (R, S) . Representative models for the quantification and results of the experiment. A circle was drawn around the endosome membrane (red) that intersects with the regions of Tf (green) and cortactin (magenta), and fluorescence intensity at each degree around the circle was measured. ( R ) Untreated cells have Tf in confined regions on the endosome and are adjacent to regions of cortactin ∼60% of the time. ( S ) CK-666-treated cells have regions of Tf that are broader and “not bounded” by cortactin.

    Journal: bioRxiv

    Article Title: Branched actin constrains endosomal cargo to control sorting and fission

    doi: 10.64898/2026.03.10.710749

    Figure Lengend Snippet: Transferrin is bounded by cortactin at endosomes. (A-L) . HeLa cells were transfected with mCherry-RAB5 Q79L and were incubated with ( A-C ) no inhibitor, ( D-F ) 25 µM SMIFH2, ( G-I ) 300 µM CK-689, or ( J-L ) 300 µM CK-666 for 4 min. Following the pre-treatment, cells were incubated with Tf-488 (and their respective inhibitor) for 6 min of uptake. (M-P) . Representative fluorescence intensity profiles of endosomes from ( M ) untreated, ( N ) SMIFH2-treated cells, ( O ) CK-689-treated cells, or ( P ) CK-666-treated cells. The intensity profile of Tf is in green, and the intensity profile of cortactin is in magenta. Tf vertices above 130% that occur within 20 degrees of a cortactin value above 130% are represented with a red circle; these peaks are “bounded”. Tf vertices above 130% that are not within 20 degrees of a cortactin value above 130% are represented with a grey circle and are “not bounded”. (Q). The percentage of “bounded” Tf peaks was quantified from fluorescence intensity profiles (as represented in ( M-P )). Quantification is from three independent experiments, and from 37 endosomes for the untreated group, 43 endosomes for SMIFH2-treated, 38 endosomes for CK-689-treated, and 37 endosomes from the CK-666-treated group. Statistical significance was determined using a two-tailed unpaired t -test (ns: p > 0.05). (R, S) . Representative models for the quantification and results of the experiment. A circle was drawn around the endosome membrane (red) that intersects with the regions of Tf (green) and cortactin (magenta), and fluorescence intensity at each degree around the circle was measured. ( R ) Untreated cells have Tf in confined regions on the endosome and are adjacent to regions of cortactin ∼60% of the time. ( S ) CK-666-treated cells have regions of Tf that are broader and “not bounded” by cortactin.

    Article Snippet: HeLa cells (ATCC-CCL-2) were cultured with complete DMEM (high glucose) (ThermoFisher Scientific, Carlsbad, CA) containing 10% fetal bovine serum (FBS) (Sigma-Aldrich), 1× penicillin-streptomycin, 100 μg/mL Normicin, and 2 mM L-glutamine at 37°C in a humidified incubator with 5% CO2.

    Techniques: Transfection, Incubation, Fluorescence, Two Tailed Test, Membrane

    Tf occupies less discrete regions on the endosome when branched actin is inhibited. (A-L) . HeLa cells were transfected with mCherry-RAB5 Q79L and were incubated with ( A-C ) no inhibitor, ( D-F ) 25 µM SMIFH2, ( G-I ) 300 µM CK-689, or ( J-L ) 300 µM CK-666 for 4 min. Following the pre-treatment, cells were incubated with Tf-488 (and their respective inhibitor) for 6 min of uptake. Untreated, SMIFH2-treated, and CK-689-treated cells show Tf localized to discrete regions on the endosome (yellow arrows). CK-666-treated cells have broader regions of Tf on the endosome (blue arrows). (M). Model for quantification. A circle (blue) was drawn around the endosome membrane (red) that intersects with the regions of Tf, and the fluorescence intensity at each degree around the circle was measured. (N-Q) . Representative fluorescence intensity profiles of Tf on the endosome from ( N ) untreated, ( O ) SMIFH2-treated, ( P ) CK-689-treated, and ( Q ) CK-666-treated cells. The profiles depicted are from the endosomes indicated with a magenta-colored star ( A-L ). (R). Tf-containing regions from the fluorescence intensity profiles ( N-Q ) were identified, and the fluorescence values ± 20 degrees from the maximum were normalized. These normalized profiles of Tf-containing regions are Tf “peaks”. The graph shows the average profile of 72 Tf peaks from 37 endosomes for the control group, 70 peaks from 43 endosomes from SMIFH2-treated cells, 73 peaks from 38 endosomes from CK-689-treated cells, and 70 peaks from 37 endosomes from CK-666-treated cells. Data are from three independent experiments. The average profile of Tf peaks in the CK-666-treated cells is broader (less discrete) than the other treatment groups. See table in Figure EV3 for statistical information.

    Journal: bioRxiv

    Article Title: Branched actin constrains endosomal cargo to control sorting and fission

    doi: 10.64898/2026.03.10.710749

    Figure Lengend Snippet: Tf occupies less discrete regions on the endosome when branched actin is inhibited. (A-L) . HeLa cells were transfected with mCherry-RAB5 Q79L and were incubated with ( A-C ) no inhibitor, ( D-F ) 25 µM SMIFH2, ( G-I ) 300 µM CK-689, or ( J-L ) 300 µM CK-666 for 4 min. Following the pre-treatment, cells were incubated with Tf-488 (and their respective inhibitor) for 6 min of uptake. Untreated, SMIFH2-treated, and CK-689-treated cells show Tf localized to discrete regions on the endosome (yellow arrows). CK-666-treated cells have broader regions of Tf on the endosome (blue arrows). (M). Model for quantification. A circle (blue) was drawn around the endosome membrane (red) that intersects with the regions of Tf, and the fluorescence intensity at each degree around the circle was measured. (N-Q) . Representative fluorescence intensity profiles of Tf on the endosome from ( N ) untreated, ( O ) SMIFH2-treated, ( P ) CK-689-treated, and ( Q ) CK-666-treated cells. The profiles depicted are from the endosomes indicated with a magenta-colored star ( A-L ). (R). Tf-containing regions from the fluorescence intensity profiles ( N-Q ) were identified, and the fluorescence values ± 20 degrees from the maximum were normalized. These normalized profiles of Tf-containing regions are Tf “peaks”. The graph shows the average profile of 72 Tf peaks from 37 endosomes for the control group, 70 peaks from 43 endosomes from SMIFH2-treated cells, 73 peaks from 38 endosomes from CK-689-treated cells, and 70 peaks from 37 endosomes from CK-666-treated cells. Data are from three independent experiments. The average profile of Tf peaks in the CK-666-treated cells is broader (less discrete) than the other treatment groups. See table in Figure EV3 for statistical information.

    Article Snippet: HeLa cells (ATCC-CCL-2) were cultured with complete DMEM (high glucose) (ThermoFisher Scientific, Carlsbad, CA) containing 10% fetal bovine serum (FBS) (Sigma-Aldrich), 1× penicillin-streptomycin, 100 μg/mL Normicin, and 2 mM L-glutamine at 37°C in a humidified incubator with 5% CO2.

    Techniques: Transfection, Incubation, Membrane, Fluorescence, Control

    EGF segregation on the endosome is affected by branched actin inhibition. (A-L) . HeLa cells were transfected with mCherry-RAB5 Q79L and were incubated with ( A-C ) no inhibitor, ( D-F ) SMIFH2, ( G-I ) CK-689, or ( J-L ) CK-666 for 4 min. Following the pre-treatment, cells were incubated with EGF-488 (and the respective inhibitor) for 17 min of uptake. Untreated, SMIFH2-treated, and CK-689-treated cells show EGF localized to discrete regions on the endosome (yellow arrows). CK-666-treated cells have broader regions of EGF on the endosome (blue arrows). (M-P) . Representative fluorescence intensity profiles of EGF on the endosome from the ( M ) untreated, ( N ) SMIFH2-treated, ( O ) CK-689-treated, and ( P ) CK-666 treated cells. The profiles depicted are from the endosomes indicated with a magenta star in ( A-L ). (Q) . EGF-containing regions from the fluorescence intensity profiles ( M-P ) were identified, and the fluorescence values ± 20 degrees from the maximum were normalized. These normalized profiles of EGF-containing regions are EGF “peaks”. The graph shows the average profile of 84 EGF peaks from 47 endosomes that were analyzed for the control group, 86 peaks from 51 endosomes from SMIFH2-treated cells, 72 peaks from 39 endosomes from CK-689-treated cells, and 86 peaks from 49 endosomes from CK-666-treated cells. Data are from three independent experiments. The average profile of EGF peaks in the CK-666-treated cells is broader (less discrete) than the other treatment groups. See table in Figure EV4 for statistical information.

    Journal: bioRxiv

    Article Title: Branched actin constrains endosomal cargo to control sorting and fission

    doi: 10.64898/2026.03.10.710749

    Figure Lengend Snippet: EGF segregation on the endosome is affected by branched actin inhibition. (A-L) . HeLa cells were transfected with mCherry-RAB5 Q79L and were incubated with ( A-C ) no inhibitor, ( D-F ) SMIFH2, ( G-I ) CK-689, or ( J-L ) CK-666 for 4 min. Following the pre-treatment, cells were incubated with EGF-488 (and the respective inhibitor) for 17 min of uptake. Untreated, SMIFH2-treated, and CK-689-treated cells show EGF localized to discrete regions on the endosome (yellow arrows). CK-666-treated cells have broader regions of EGF on the endosome (blue arrows). (M-P) . Representative fluorescence intensity profiles of EGF on the endosome from the ( M ) untreated, ( N ) SMIFH2-treated, ( O ) CK-689-treated, and ( P ) CK-666 treated cells. The profiles depicted are from the endosomes indicated with a magenta star in ( A-L ). (Q) . EGF-containing regions from the fluorescence intensity profiles ( M-P ) were identified, and the fluorescence values ± 20 degrees from the maximum were normalized. These normalized profiles of EGF-containing regions are EGF “peaks”. The graph shows the average profile of 84 EGF peaks from 47 endosomes that were analyzed for the control group, 86 peaks from 51 endosomes from SMIFH2-treated cells, 72 peaks from 39 endosomes from CK-689-treated cells, and 86 peaks from 49 endosomes from CK-666-treated cells. Data are from three independent experiments. The average profile of EGF peaks in the CK-666-treated cells is broader (less discrete) than the other treatment groups. See table in Figure EV4 for statistical information.

    Article Snippet: HeLa cells (ATCC-CCL-2) were cultured with complete DMEM (high glucose) (ThermoFisher Scientific, Carlsbad, CA) containing 10% fetal bovine serum (FBS) (Sigma-Aldrich), 1× penicillin-streptomycin, 100 μg/mL Normicin, and 2 mM L-glutamine at 37°C in a humidified incubator with 5% CO2.

    Techniques: Inhibition, Transfection, Incubation, Fluorescence, Control

    The degradative and retrieval subdomains on endosomes coalesce upon branched actin inhibition. (A-F) . HeLa cells were transfected with mCherry-RAB5 Q79L and were co-incubated with EGF-488 and anti-CD59 antibody for 20 min. During the last 5 min of uptake, either ( A-C ) no inhibitor or ( D-F ) 300 µM CK-666 was added to the media. Pearson’s and Manders’ correlation coefficients for each representative image are listed. (G). ImageJ was used to calculate Pearson’s correlation coefficient for 47 ROIs in the untreated group and 42 ROIs in the CK-666-treated group from three independent experiments. Statistical significance was determined using an unpaired two-tailed t -test. (H, I) . ImageJ was used to calculate Manders’ correlation coefficients (M1 and M2) for 47 ROIs in the untreated group and 42 ROIs in the CK-666-treated group from three independent experiments. Statistical significance was determined using an unpaired two-tailed t -test.

    Journal: bioRxiv

    Article Title: Branched actin constrains endosomal cargo to control sorting and fission

    doi: 10.64898/2026.03.10.710749

    Figure Lengend Snippet: The degradative and retrieval subdomains on endosomes coalesce upon branched actin inhibition. (A-F) . HeLa cells were transfected with mCherry-RAB5 Q79L and were co-incubated with EGF-488 and anti-CD59 antibody for 20 min. During the last 5 min of uptake, either ( A-C ) no inhibitor or ( D-F ) 300 µM CK-666 was added to the media. Pearson’s and Manders’ correlation coefficients for each representative image are listed. (G). ImageJ was used to calculate Pearson’s correlation coefficient for 47 ROIs in the untreated group and 42 ROIs in the CK-666-treated group from three independent experiments. Statistical significance was determined using an unpaired two-tailed t -test. (H, I) . ImageJ was used to calculate Manders’ correlation coefficients (M1 and M2) for 47 ROIs in the untreated group and 42 ROIs in the CK-666-treated group from three independent experiments. Statistical significance was determined using an unpaired two-tailed t -test.

    Article Snippet: HeLa cells (ATCC-CCL-2) were cultured with complete DMEM (high glucose) (ThermoFisher Scientific, Carlsbad, CA) containing 10% fetal bovine serum (FBS) (Sigma-Aldrich), 1× penicillin-streptomycin, 100 μg/mL Normicin, and 2 mM L-glutamine at 37°C in a humidified incubator with 5% CO2.

    Techniques: Inhibition, Transfection, Incubation, Two Tailed Test